Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CGGCTCTGATACCAATTGATG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14c12,217,477Phasing windowAT4G23387c12,217,44712,217,527MIR845a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24c12,217,477Phasing windowath-MIR845ac12,217,40612,217,568miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1224,877,516  592345
C0F222,789,465  1147
d1F113,574,742  1113
d1F213,705,660  1113
d234F1111,417,116  8163978
d234F2593,822,319  153177154
r2F1502,195,923  2346114228
r2F21982,233,522  89177443886
r2FSb1505,728,276  2652131262
r2FNaSb1835,311,047  3469172345
r2FNa1401,834,656  2244109218
r2FNa21886,081,068  3162155309
r2FL181,145,942  163179157
r2FD1344,928,142  2754136272
C0FCSb29,399,678  1112
C0FSb59,361,008  1135
r2SC1103,743,342  351327
r2SH32,165,395  13714
r2SNa102,082,930  0000
r2SC383,997,922  241020
r2SNa284,617,795  23917
r2SSb133,278,680  482040
r2SNaSb73,087,212  251123
r2SC210476,105  2142105210
r2SP2976,646  241020
C0RC1101,249,181  8164080
C0RNi111,211,490  9184591
AtCM7714,488,208  5112753
AT_Leaf188,047,907  241122
At_miR1507OX_111,478,373  1137
At_miR1507OX_201,638,916  0000
At_miR2109OX_111,760,055  1136
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_202,496,180  0000
At_miROX_control11,838,508  1135
At_miROX_ck_201,804,409  0000
hen1-8745,456,831  142768136
hen1-8 ntp2-1566,244,400  9184590
hen1-8 urt1-11216,081,292  204099199
hen1-8 ntp4-1794,626,878  173485171
hen1-8 ntp5-11145,676,073  2040100201
hen1-8 ntp6-13104,328,718  72143358716
hen1-8 ntp7-1604,409,080  142768136
hen1-8 ntp8-11028,736,008  122358117
hen1-8 ntp10-1966,387,459  153075150
hen1-8 r2272,874,203  9194794
hen1-8 heso1-11336,015,054  2244111221
hen1-8 mee44333,435,030  10194896
Wt_d1057,517,450  142870140
Col_d25311,692,099  2243108216


Link to FindMiRNA for this sequence