Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CGTACAAGGAGTCAAGCATGA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c19,009,115Phasing windowAT5G46845c19,009,09819,009,178MIR160/MIR160C (MICRORNA160); miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c19,009,115Phasing windowath-MIR160cc19,009,09419,009,182miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1144,877,516  361429
C0F202,789,465  0000
d1F103,574,742  0000
d1F223,705,660  1135
d234F1111,417,116  8163978
d234F2493,822,319  132664128
r2F1222,195,923  102050100
r2F2532,233,522  2447119237
r2FSb2275,728,276  4079198396
r2FNaSb1635,311,047  3161153307
r2FNa1121,834,656  7133365
r2FNa21656,081,068  2754136271
r2FL61,145,942  5102652
r2FD3074,928,142  62125311623
C0FCSb19,399,678  1111
C0FSb29,361,008  1112
r2SC1293,743,342  8153977
r2SH492,165,395  2345113226
r2SNa1222,082,930  112153106
r2SC3513,997,922  132664128
r2SNa21184,617,795  2651128256
r2SSb3143,278,680  96192479958
r2SNaSb873,087,212  2856141282
r2SC21476,105  241121
r2SP12976,646  122561123
C0RC1121,249,181  10194896
C0RNi571,211,490  4794235470
AtCM814,488,208  1136
AT_Leaf2,5918,047,907  3226441,6103,219
At_miR1507OX_131,478,373  241020
At_miR1507OX_231,638,916  24918
At_miR2109OX_121,760,055  12611
At_miR2109OX_222,446,954  1248
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_132,023,619  13715
At_miR2118bOX_241,733,586  251223
At_miR2118cOX_131,995,522  23815
At_miR2118cOX_232,496,180  12612
At_miROX_control21,838,508  12511
At_miROX_ck_231,804,409  23817
hen1-855,456,831  1259
hen1-8 ntp2-186,244,400  13613
hen1-8 urt1-156,081,292  1248
hen1-8 ntp4-154,626,878  12511
hen1-8 ntp5-195,676,073  23816
hen1-8 ntp6-1634,328,718  152973146
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-136,387,459  1125
hen1-8 r242,874,203  13714
hen1-8 heso1-146,015,054  1137
hen1-8 mee4433,435,030  1249
Wt_d387,517,450  5102551
Col_d711,692,099  1136


Link to FindMiRNA for this sequence