Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CTGAAGTGTTTGGGGGAACTC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 3

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c9,363,226Phasing windowAT1G26973c9,363,1969,363,288MIR395A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c9,363,226Phasing windowath-MIR395ac9,363,1969,363,288miRNA
31c26,270,009Phasing windowAT1G69792c26,269,97926,270,078MIR395D; miRNA
41c26,270,009Phasing windowath-MIR395dc26,269,97926,270,078miRNA
51c26,272,806Phasing windowAT1G69795c26,272,77626,272,870MIR395E; miRNA
61c26,272,806Phasing windowath-MIR395ec26,272,77626,272,870miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1114,877,516  251123
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F181,417,116  6112856
d234F2233,822,319  6123060
r2F1102,195,923  592346
r2F2152,233,522  7133467
r2FSb485,728,276  8174284
r2FNaSb695,311,047  132665130
r2FNa1211,834,656  112357114
r2FNa21636,081,068  2754134268
r2FL151,145,942  132665131
r2FD634,928,142  132664128
C0FCSb39,399,678  1123
C0FSb49,361,008  1124
r2SC123,743,342  1135
r2SH92,165,395  482142
r2SNa172,082,930  371734
r2SC3213,997,922  5112653
r2SNa2254,617,795  5112754
r2SSb453,278,680  142769137
r2SNaSb293,087,212  9194794
r2SC25476,105  112153105
r2SP0976,646  0000
C0RC1241,249,181  193896192
C0RNi51,211,490  482141
AtCM314,488,208  1112
AT_Leaf5838,047,907  72145362724
At_miR1507OX_171,478,373  592447
At_miR1507OX_211,638,916  1136
At_miR2109OX_121,760,055  12611
At_miR2109OX_262,446,954  251225
At_miR2118aOX_161,212,493  5102549
At_miR2118aOX_241,258,140  361632
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_151,995,522  351325
At_miR2118cOX_222,496,180  1248
At_miROX_control61,838,508  371633
At_miROX_ck_231,804,409  23817
hen1-8115,456,831  241020
hen1-8 ntp2-1236,244,400  471837
hen1-8 urt1-166,081,292  12510
hen1-8 ntp4-1324,626,878  7143569
hen1-8 ntp5-1705,676,073  122562123
hen1-8 ntp6-11164,328,718  2754134268
hen1-8 ntp7-1134,409,080  361529
hen1-8 ntp8-1638,736,008  7143672
hen1-8 ntp10-1516,387,459  8164080
hen1-8 r2172,874,203  6123059
hen1-8 heso1-1176,015,054  361428
hen1-8 mee44223,435,030  6133264
Wt_d317,517,450  482141
Col_d13011,692,099  112256111


Link to FindMiRNA for this sequence