Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CTGAAGTGTTTGGGGGGACTC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 3

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	9,364,540	Phasing window	AT1G26975	w	9,364,471	9,364,570	MIR395B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	9,364,540	Phasing window	ath-MIR395b	w	9,364,471	9,364,570	miRNA
3	1	w	9,367,149	Phasing window	AT1G26985	w	9,367,080	9,367,179	MIR395C; miRNA
4	1	w	9,367,149	Phasing window	ath-MIR395c	w	9,367,080	9,367,179	miRNA
5	1	w	26,273,939	Phasing window	AT1G69797	w	26,273,858	26,273,969	MIR395F; miRNA
6	1	w	26,273,939	Phasing window	ath-MIR395f	w	26,273,858	26,273,969	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	12	4,877,516	2	5	12	25
C0F2	0	2,789,465	0	0	0	0
d1F1	3	3,574,742	1	2	4	8
d1F2	0	3,705,660	0	0	0	0
d234F1	12	1,417,116	8	17	42	85
d234F2	39	3,822,319	10	20	51	102
r2F1	31	2,195,923	14	28	71	141
r2F2	13	2,233,522	6	12	29	58
r2FSb	39	5,728,276	7	14	34	68
r2FNaSb	70	5,311,047	13	26	66	132
r2FNa1	44	1,834,656	24	48	120	240
r2FNa2	175	6,081,068	29	58	144	288
r2FL	20	1,145,942	17	35	87	175
r2FD	58	4,928,142	12	24	59	118
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	2	9,361,008	1	1	1	2
r2SC1	8	3,743,342	2	4	11	21
r2SH	4	2,165,395	2	4	9	18
r2SNa1	2	2,082,930	1	2	5	10
r2SC3	23	3,997,922	6	12	29	58
r2SNa2	49	4,617,795	11	21	53	106
r2SSb	54	3,278,680	16	33	82	165
r2SNaSb	26	3,087,212	8	17	42	84
r2SC2	4	476,105	8	17	42	84
r2SP	2	976,646	2	4	10	20
C0RC1	8	1,249,181	6	13	32	64
C0RNi	10	1,211,490	8	17	41	83
AtCM	9	14,488,208	1	1	3	6
AT_Leaf	174	8,047,907	22	43	108	216
At_miR1507OX_1	23	1,478,373	16	31	78	156
At_miR1507OX_2	6	1,638,916	4	7	18	37
At_miR2109OX_1	15	1,760,055	9	17	43	85
At_miR2109OX_2	17	2,446,954	7	14	35	69
At_miR2118aOX_1	11	1,212,493	9	18	45	91
At_miR2118aOX_2	30	1,258,140	24	48	119	238
At_miR2118bOX_1	7	2,023,619	3	7	17	35
At_miR2118bOX_2	2	1,733,586	1	2	6	12
At_miR2118cOX_1	43	1,995,522	22	43	108	215
At_miR2118cOX_2	27	2,496,180	11	22	54	108
At_miROX_control	27	1,838,508	15	29	73	147
At_miROX_ck_2	16	1,804,409	9	18	44	89
hen1-8	12	5,456,831	2	4	11	22
hen1-8 ntp2-1	28	6,244,400	4	9	22	45
hen1-8 urt1-1	13	6,081,292	2	4	11	21
hen1-8 ntp4-1	22	4,626,878	5	10	24	48
hen1-8 ntp5-1	52	5,676,073	9	18	46	92
hen1-8 ntp6-1	48	4,328,718	11	22	55	111
hen1-8 ntp7-1	17	4,409,080	4	8	19	39
hen1-8 ntp8-1	15	8,736,008	2	3	9	17
hen1-8 ntp10-1	12	6,387,459	2	4	9	19
hen1-8 r2	20	2,874,203	7	14	35	70
hen1-8 heso1-1	35	6,015,054	6	12	29	58
hen1-8 mee44	24	3,435,030	7	14	35	70
Wt_d	40	7,517,450	5	11	27	53
Col_d	75	11,692,099	6	13	32	64

Link to FindMiRNA for this sequence