Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CTTTATATCCGCATTTGCGCA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c234,037Phasing windowAT1G01650c232,841237,817SIGNAL PEPTIDE PEPTIDASE-LIKE 4

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c234,037Phasing windowath-MIR2112c234,006234,159miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F164,877,516  12612
C0F202,789,465  0000
d1F113,574,742  1113
d1F203,705,660  0000
d234F141,417,116  361428
d234F2153,822,319  482039
r2F1142,195,923  6133264
r2F2682,233,522  3061152304
r2FSb535,728,276  9194693
r2FNaSb545,311,047  102051102
r2FNa1211,834,656  112357114
r2FNa2566,081,068  9184692
r2FL71,145,942  6123161
r2FD234,928,142  592347
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC133,743,342  1248
r2SH282,165,395  132665129
r2SNa142,082,930  241019
r2SC363,997,922  23815
r2SNa274,617,795  23815
r2SSb53,278,680  23815
r2SNaSb113,087,212  471836
r2SC20476,105  0000
r2SP0976,646  0000
C0RC1281,249,181  2245112224
C0RNi81,211,490  7133366
AtCM314,488,208  1112
AT_Leaf238,047,907  361429
At_miR1507OX_101,478,373  0000
At_miR1507OX_221,638,916  12612
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_131,995,522  23815
At_miR2118cOX_202,496,180  0000
At_miROX_control11,838,508  1135
At_miROX_ck_231,804,409  23817
hen1-845,456,831  1147
hen1-8 ntp2-136,244,400  1125
hen1-8 urt1-166,081,292  12510
hen1-8 ntp4-144,626,878  1249
hen1-8 ntp5-155,676,073  1249
hen1-8 ntp6-1114,328,718  351325
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-128,736,008  1112
hen1-8 ntp10-106,387,459  0000
hen1-8 r232,874,203  12510
hen1-8 heso1-156,015,054  1248
hen1-8 mee4403,435,030  0000
Wt_d1477,517,450  203998196
Col_d411,692,099  1123


Link to FindMiRNA for this sequence