Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CTTTGTCTACAATTTTGGAAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	c	3,366,411	Phasing window	AT3G10745	c	3,366,331	3,366,430	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	c	3,366,411	Phasing window	ath-MIR158a	c	3,366,331	3,366,430	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	6	4,877,516	1	2	6	12
C0F2	0	2,789,465	0	0	0	0
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	18	1,417,116	13	25	64	127
d234F2	15	3,822,319	4	8	20	39
r2F1	23	2,195,923	10	21	52	105
r2F2	196	2,233,522	88	176	439	878
r2FSb	63	5,728,276	11	22	55	110
r2FNaSb	47	5,311,047	9	18	44	88
r2FNa1	8	1,834,656	4	9	22	44
r2FNa2	14	6,081,068	2	5	12	23
r2FL	17	1,145,942	15	30	74	148
r2FD	47	4,928,142	10	19	48	95
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	1	9,361,008	1	1	1	1
r2SC1	8	3,743,342	2	4	11	21
r2SH	4	2,165,395	2	4	9	18
r2SNa1	12	2,082,930	6	12	29	58
r2SC3	1	3,997,922	1	1	1	3
r2SNa2	4	4,617,795	1	2	4	9
r2SSb	0	3,278,680	0	0	0	0
r2SNaSb	2	3,087,212	1	1	3	6
r2SC2	11	476,105	23	46	116	231
r2SP	5	976,646	5	10	26	51
C0RC1	15	1,249,181	12	24	60	120
C0RNi	4	1,211,490	3	7	17	33
AtCM	21	14,488,208	1	3	7	14
AT_Leaf	250	8,047,907	31	62	155	311
At_miR1507OX_1	14	1,478,373	9	19	47	95
At_miR1507OX_2	44	1,638,916	27	54	134	268
At_miR2109OX_1	36	1,760,055	20	41	102	205
At_miR2109OX_2	27	2,446,954	11	22	55	110
At_miR2118aOX_1	11	1,212,493	9	18	45	91
At_miR2118aOX_2	20	1,258,140	16	32	79	159
At_miR2118bOX_1	19	2,023,619	9	19	47	94
At_miR2118bOX_2	15	1,733,586	9	17	43	87
At_miR2118cOX_1	45	1,995,522	23	45	113	226
At_miR2118cOX_2	24	2,496,180	10	19	48	96
At_miROX_control	23	1,838,508	13	25	63	125
At_miROX_ck_2	23	1,804,409	13	25	64	127
hen1-8	67	5,456,831	12	25	61	123
hen1-8 ntp2-1	62	6,244,400	10	20	50	99
hen1-8 urt1-1	57	6,081,292	9	19	47	94
hen1-8 ntp4-1	51	4,626,878	11	22	55	110
hen1-8 ntp5-1	124	5,676,073	22	44	109	218
hen1-8 ntp6-1	893	4,328,718	206	413	1,031	2,063
hen1-8 ntp7-1	52	4,409,080	12	24	59	118
hen1-8 ntp8-1	90	8,736,008	10	21	52	103
hen1-8 ntp10-1	69	6,387,459	11	22	54	108
hen1-8 r2	15	2,874,203	5	10	26	52
hen1-8 heso1-1	12	6,015,054	2	4	10	20
hen1-8 mee44	31	3,435,030	9	18	45	90
Wt_d	81	7,517,450	11	22	54	108
Col_d	888	11,692,099	76	152	380	759

Link to FindMiRNA for this sequence