Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GAGCTCCTTGAAGTTCAATGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w6,220,650Phasing windowAT1G18075w6,220,6486,220,833MIR159/MIR159B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w6,220,650Phasing windowath-MIR159bw6,220,6466,220,841miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1164,877,516  371633
C0F232,789,465  12511
d1F113,574,742  1113
d1F203,705,660  0000
d234F181,417,116  6112856
d234F223,822,319  1135
r2F1442,195,923  2040100200
r2F242,233,522  24918
r2FSb565,728,276  10204998
r2FNaSb225,311,047  482141
r2FNa1411,834,656  2245112223
r2FNa2296,081,068  5102448
r2FL81,145,942  7143570
r2FD154,928,142  361530
C0FCSb29,399,678  1112
C0FSb79,361,008  1147
r2SC163,743,342  23816
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC343,997,922  12510
r2SNa244,617,795  1249
r2SSb163,278,680  5102449
r2SNaSb23,087,212  1136
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM1,31614,488,208  91182454908
AT_Leaf1128,047,907  142870139
At_miR1507OX_101,478,373  0000
At_miR1507OX_231,638,916  24918
At_miR2109OX_111,760,055  1136
At_miR2109OX_222,446,954  1248
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_242,496,180  23816
At_miROX_control41,838,508  241122
At_miROX_ck_241,804,409  241122
hen1-805,456,831  0000
hen1-8 ntp2-126,244,400  1123
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-1164,328,718  471837
hen1-8 ntp7-124,409,080  1125
hen1-8 ntp8-158,736,008  1136
hen1-8 ntp10-126,387,459  1123
hen1-8 r222,874,203  1137
hen1-8 heso1-106,015,054  0000
hen1-8 mee4413,435,030  1113
Wt_d147,517,450  24919
Col_d911,692,099  1248


Link to FindMiRNA for this sequence