Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GATCCCCGGCAACGGCGCCA
Length: 20 nucleotides
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	3,740,938	Phasing window	Link to IGR (2,787 bp)			Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	w	16,161,749	Phasing window	Link to IGR (2,814 bp)			Small region at sequence (3 kb)

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	62	4,877,516	13	25	64	127
C0F2	4	2,789,465	1	3	7	14
d1F1	234	3,574,742	65	131	327	655
d1F2	83	3,705,660	22	45	112	224
d234F1	632	1,417,116	446	892	2,230	4,460
d234F2	11	3,822,319	3	6	14	29
r2F1	681	2,195,923	310	620	1,551	3,101
r2F2	29	2,233,522	13	26	65	130
r2FSb	355	5,728,276	62	124	310	620
r2FNaSb	582	5,311,047	110	219	548	1,096
r2FNa1	682	1,834,656	372	743	1,859	3,717
r2FNa2	574	6,081,068	94	189	472	944
r2FL	308	1,145,942	269	538	1,344	2,688
r2FD	1,833	4,928,142	372	744	1,860	3,719
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	2	9,361,008	1	1	1	2
r2SC1	54	3,743,342	14	29	72	144
r2SH	599	2,165,395	277	553	1,383	2,766
r2SNa1	33	2,082,930	16	32	79	158
r2SC3	236	3,997,922	59	118	295	590
r2SNa2	1,106	4,617,795	240	479	1,198	2,395
r2SSb	71	3,278,680	22	43	108	217
r2SNaSb	359	3,087,212	116	233	581	1,163
r2SC2	0	476,105	0	0	0	0
r2SP	1	976,646	1	2	5	10
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	15	14,488,208	1	2	5	10
AT_Leaf	13	8,047,907	2	3	8	16
At_miR1507OX_1	1,037	1,478,373	701	1,403	3,507	7,014
At_miR1507OX_2	1,085	1,638,916	662	1,324	3,310	6,620
At_miR2109OX_1	718	1,760,055	408	816	2,040	4,079
At_miR2109OX_2	646	2,446,954	264	528	1,320	2,640
At_miR2118aOX_1	457	1,212,493	377	754	1,885	3,769
At_miR2118aOX_2	786	1,258,140	625	1,249	3,124	6,247
At_miR2118bOX_1	628	2,023,619	310	621	1,552	3,103
At_miR2118bOX_2	1,164	1,733,586	671	1,343	3,357	6,714
At_miR2118cOX_1	822	1,995,522	412	824	2,060	4,119
At_miR2118cOX_2	511	2,496,180	205	409	1,024	2,047
At_miROX_control	648	1,838,508	352	705	1,762	3,525
At_miROX_ck_2	742	1,804,409	411	822	2,056	4,112
hen1-8	12	5,456,831	2	4	11	22
hen1-8 ntp2-1	19	6,244,400	3	6	15	30
hen1-8 urt1-1	12	6,081,292	2	4	10	20
hen1-8 ntp4-1	19	4,626,878	4	8	21	41
hen1-8 ntp5-1	15	5,676,073	3	5	13	26
hen1-8 ntp6-1	62	4,328,718	14	29	72	143
hen1-8 ntp7-1	11	4,409,080	2	5	12	25
hen1-8 ntp8-1	15	8,736,008	2	3	9	17
hen1-8 ntp10-1	10	6,387,459	2	3	8	16
hen1-8 r2	3	2,874,203	1	2	5	10
hen1-8 heso1-1	8	6,015,054	1	3	7	13
hen1-8 mee44	13	3,435,030	4	8	19	38
Wt_d	743	7,517,450	99	198	494	988
Col_d	132	11,692,099	11	23	56	113

Link to FindMiRNA for this sequence