Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GATGGATATGTCTTCAAGGAC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c17,838,174Phasing windowAT3G48201c17,838,13517,838,266MIR861a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23c17,838,174Phasing windowath-MIR861c17,838,13517,838,266miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F223,822,319  1135
r2F162,195,923  351427
r2F2102,233,522  492245
r2FSb665,728,276  122358115
r2FNaSb265,311,047  5102449
r2FNa111,834,656  1135
r2FNa2266,081,068  492143
r2FL31,145,942  351326
r2FD494,928,142  10205099
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC153,743,342  13713
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC343,997,922  12510
r2SNa254,617,795  12511
r2SSb63,278,680  24918
r2SNaSb13,087,212  1123
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM414,488,208  1113
AT_Leaf38,047,907  1124
At_miR1507OX_141,478,373  351427
At_miR1507OX_291,638,916  5112755
At_miR2109OX_181,760,055  592345
At_miR2109OX_2172,446,954  7143569
At_miR2118aOX_131,212,493  251225
At_miR2118aOX_2131,258,140  102152103
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_231,733,586  23917
At_miR2118cOX_1201,995,522  102050100
At_miR2118cOX_232,496,180  12612
At_miROX_control51,838,508  351427
At_miROX_ck_211,804,409  1136
hen1-82085,456,831  3876191381
hen1-8 ntp2-13156,244,400  50101252504
hen1-8 urt1-12106,081,292  3569173345
hen1-8 ntp4-11664,626,878  3672179359
hen1-8 ntp5-14435,676,073  78156390780
hen1-8 ntp6-12,0954,328,718  4849682,4204,840
hen1-8 ntp7-11924,409,080  4487218435
hen1-8 ntp8-13228,736,008  3774184369
hen1-8 ntp10-12116,387,459  3366165330
hen1-8 r21262,874,203  4488219438
hen1-8 heso1-12476,015,054  4182205411
hen1-8 mee442423,435,030  70141352705
Wt_d07,517,450  0000
Col_d6511,692,099  6112856


Link to FindMiRNA for this sequence