Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCAACATCTTCAAGATTCAGA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13w20,587,921Phasing windowAT3G55512w20,587,90420,588,027MIR172D; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23w20,587,921Phasing windowath-MIR172dw20,587,90420,588,027miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F164,877,516  12612
C0F212,789,465  1124
d1F133,574,742  1248
d1F233,705,660  1248
d234F131,417,116  241121
d234F2403,822,319  102152105
r2F1202,195,923  9184691
r2F2252,233,522  112256112
r2FSb365,728,276  6133163
r2FNaSb235,311,047  492243
r2FNa1121,834,656  7133365
r2FNa2306,081,068  5102549
r2FL171,145,942  153074148
r2FD114,928,142  241122
C0FCSb09,399,678  0000
C0FSb49,361,008  1124
r2SC113,743,342  1113
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC111,249,181  1248
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control11,838,508  1135
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-146,244,400  1136
hen1-8 urt1-126,081,292  1123
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-165,676,073  12511
hen1-8 ntp6-1104,328,718  251223
hen1-8 ntp7-144,409,080  1259
hen1-8 ntp8-188,736,008  1259
hen1-8 ntp10-126,387,459  1123
hen1-8 r242,874,203  13714
hen1-8 heso1-146,015,054  1137
hen1-8 mee4483,435,030  251223
Wt_d17,517,450  1111
Col_d5911,692,099  5102550


Link to FindMiRNA for this sequence