Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCAAGTTGACCTTGGCTCTGC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c4,805,733Phasing windowAT3G14385c4,805,6844,805,850miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23c4,805,733Phasing windowath-MIR169fc4,805,6844,805,850miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F194,877,516  24918
C0F202,789,465  0000
d1F123,574,742  1136
d1F213,705,660  1113
d234F111,417,116  1147
d234F243,822,319  12510
r2F172,195,923  361632
r2F2432,233,522  193996193
r2FSb135,728,276  251123
r2FNaSb315,311,047  6122958
r2FNa1361,834,656  203998196
r2FNa296,081,068  13715
r2FL391,145,942  3468170340
r2FD364,928,142  7153773
C0FCSb09,399,678  0000
C0FSb49,361,008  1124
r2SC1103,743,342  351327
r2SH72,165,395  361632
r2SNa102,082,930  0000
r2SC3313,997,922  8163978
r2SNa2714,617,795  153177154
r2SSb213,278,680  6133264
r2SNaSb163,087,212  5102652
r2SC294476,105  1973959871,974
r2SP67976,646  69137343686
C0RC1351,249,181  2856140280
C0RNi31,211,490  251225
AtCM1,61314,488,208  1112235571,113
AT_Leaf1818,047,907  2245112225
At_miR1507OX_1101,478,373  7143468
At_miR1507OX_2181,638,916  112255110
At_miR2109OX_1241,760,055  142768136
At_miR2109OX_2142,446,954  6112957
At_miR2118aOX_1101,212,493  8164182
At_miR2118aOX_2161,258,140  132564127
At_miR2118bOX_1122,023,619  6123059
At_miR2118bOX_2121,733,586  7143569
At_miR2118cOX_1261,995,522  132665130
At_miR2118cOX_292,496,180  471836
At_miROX_control211,838,508  112357114
At_miROX_ck_2241,804,409  132767133
hen1-815,456,831  1112
hen1-8 ntp2-1116,244,400  24918
hen1-8 urt1-166,081,292  12510
hen1-8 ntp4-134,626,878  1136
hen1-8 ntp5-155,676,073  1249
hen1-8 ntp6-1224,328,718  5102551
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-1128,736,008  13714
hen1-8 ntp10-136,387,459  1125
hen1-8 r252,874,203  23917
hen1-8 heso1-1116,015,054  24918
hen1-8 mee4443,435,030  12612
Wt_d87,517,450  12511
Col_d611,692,099  1135


Link to FindMiRNA for this sequence