Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GCAGCACCATTAAGATTCAC
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	c	1,188,297	Phasing window	AT5G04275	c	1,188,211	1,188,299	MIR172/MIR172B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	c	1,188,297	Phasing window	ath-MIR172b	c	1,188,207	1,188,301	miRNA
3	5	w	23,988,484	Phasing window	AT5G59505	w	23,988,472	23,988,596	MIR172E; miRNA
4	5	w	23,988,484	Phasing window	ath-MIR172e	w	23,988,472	23,988,596	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	11	4,877,516	2	5	11	23
C0F2	16	2,789,465	6	11	29	57
d1F1	4	3,574,742	1	2	6	11
d1F2	1	3,705,660	1	1	1	3
d234F1	11	1,417,116	8	16	39	78
d234F2	242	3,822,319	63	127	317	633
r2F1	25	2,195,923	11	23	57	114
r2F2	5	2,233,522	2	4	11	22
r2FSb	107	5,728,276	19	37	93	187
r2FNaSb	91	5,311,047	17	34	86	171
r2FNa1	37	1,834,656	20	40	101	202
r2FNa2	36	6,081,068	6	12	30	59
r2FL	72	1,145,942	63	126	314	628
r2FD	109	4,928,142	22	44	111	221
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	5	9,361,008	1	1	3	5
r2SC1	9	3,743,342	2	5	12	24
r2SH	21	2,165,395	10	19	48	97
r2SNa1	5	2,082,930	2	5	12	24
r2SC3	23	3,997,922	6	12	29	58
r2SNa2	22	4,617,795	5	10	24	48
r2SSb	42	3,278,680	13	26	64	128
r2SNaSb	36	3,087,212	12	23	58	117
r2SC2	7	476,105	15	29	74	147
r2SP	3	976,646	3	6	15	31
C0RC1	4	1,249,181	3	6	16	32
C0RNi	0	1,211,490	0	0	0	0
AtCM	2	14,488,208	1	1	1	1
AT_Leaf	316	8,047,907	39	79	196	393
At_miR1507OX_1	33	1,478,373	22	45	112	223
At_miR1507OX_2	28	1,638,916	17	34	85	171
At_miR2109OX_1	23	1,760,055	13	26	65	131
At_miR2109OX_2	37	2,446,954	15	30	76	151
At_miR2118aOX_1	18	1,212,493	15	30	74	148
At_miR2118aOX_2	29	1,258,140	23	46	115	230
At_miR2118bOX_1	21	2,023,619	10	21	52	104
At_miR2118bOX_2	13	1,733,586	7	15	37	75
At_miR2118cOX_1	63	1,995,522	32	63	158	316
At_miR2118cOX_2	25	2,496,180	10	20	50	100
At_miROX_control	21	1,838,508	11	23	57	114
At_miROX_ck_2	7	1,804,409	4	8	19	39
hen1-8	12	5,456,831	2	4	11	22
hen1-8 ntp2-1	8	6,244,400	1	3	6	13
hen1-8 urt1-1	13	6,081,292	2	4	11	21
hen1-8 ntp4-1	15	4,626,878	3	6	16	32
hen1-8 ntp5-1	10	5,676,073	2	4	9	18
hen1-8 ntp6-1	47	4,328,718	11	22	54	109
hen1-8 ntp7-1	9	4,409,080	2	4	10	20
hen1-8 ntp8-1	20	8,736,008	2	5	11	23
hen1-8 ntp10-1	13	6,387,459	2	4	10	20
hen1-8 r2	11	2,874,203	4	8	19	38
hen1-8 heso1-1	4	6,015,054	1	1	3	7
hen1-8 mee44	20	3,435,030	6	12	29	58
Wt_d	6	7,517,450	1	2	4	8
Col_d	127	11,692,099	11	22	54	109

Link to FindMiRNA for this sequence