Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GCTCAAGAAAGCTGTGGGAAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	w	13,611,904	Phasing window	AT5G35407	w	13,611,798	13,611,932	MIR396B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	w	13,611,904	Phasing window	ath-MIR396b	w	13,611,798	13,611,932	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1,205	4,877,516	247	494	1,235	2,471
C0F2	567	2,789,465	203	407	1,016	2,033
d1F1	180	3,574,742	50	101	252	504
d1F2	285	3,705,660	77	154	385	769
d234F1	885	1,417,116	625	1,249	3,123	6,245
d234F2	2,551	3,822,319	667	1,335	3,337	6,674
r2F1	3,770	2,195,923	1,717	3,434	8,584	17,168
r2F2	783	2,233,522	351	701	1,753	3,506
r2FSb	10,721	5,728,276	1,872	3,743	9,358	18,716
r2FNaSb	4,163	5,311,047	784	1,568	3,919	7,838
r2FNa1	3,312	1,834,656	1,805	3,610	9,026	18,052
r2FNa2	1,975	6,081,068	325	650	1,624	3,248
r2FL	3,286	1,145,942	2,868	5,735	14,338	28,675
r2FD	3,049	4,928,142	619	1,237	3,093	6,187
C0FCSb	345	9,399,678	37	73	184	367
C0FSb	878	9,361,008	94	188	469	938
r2SC1	757	3,743,342	202	404	1,011	2,022
r2SH	1,321	2,165,395	610	1,220	3,050	6,101
r2SNa1	241	2,082,930	116	231	579	1,157
r2SC3	713	3,997,922	178	357	892	1,783
r2SNa2	2,994	4,617,795	648	1,297	3,242	6,484
r2SSb	1,267	3,278,680	386	773	1,932	3,864
r2SNaSb	562	3,087,212	182	364	910	1,820
r2SC2	20	476,105	42	84	210	420
r2SP	10	976,646	10	20	51	102
C0RC1	3	1,249,181	2	5	12	24
C0RNi	9	1,211,490	7	15	37	74
AtCM	30	14,488,208	2	4	10	21
AT_Leaf	1,616	8,047,907	201	402	1,004	2,008
At_miR1507OX_1	53	1,478,373	36	72	179	359
At_miR1507OX_2	67	1,638,916	41	82	204	409
At_miR2109OX_1	38	1,760,055	22	43	108	216
At_miR2109OX_2	73	2,446,954	30	60	149	298
At_miR2118aOX_1	30	1,212,493	25	49	124	247
At_miR2118aOX_2	57	1,258,140	45	91	227	453
At_miR2118bOX_1	44	2,023,619	22	43	109	217
At_miR2118bOX_2	38	1,733,586	22	44	110	219
At_miR2118cOX_1	122	1,995,522	61	122	306	611
At_miR2118cOX_2	51	2,496,180	20	41	102	204
At_miROX_control	35	1,838,508	19	38	95	190
At_miROX_ck_2	48	1,804,409	27	53	133	266
hen1-8	50	5,456,831	9	18	46	92
hen1-8 ntp2-1	43	6,244,400	7	14	34	69
hen1-8 urt1-1	37	6,081,292	6	12	30	61
hen1-8 ntp4-1	46	4,626,878	10	20	50	99
hen1-8 ntp5-1	88	5,676,073	16	31	78	155
hen1-8 ntp6-1	392	4,328,718	91	181	453	906
hen1-8 ntp7-1	33	4,409,080	7	15	37	75
hen1-8 ntp8-1	70	8,736,008	8	16	40	80
hen1-8 ntp10-1	47	6,387,459	7	15	37	74
hen1-8 r2	43	2,874,203	15	30	75	150
hen1-8 heso1-1	61	6,015,054	10	20	51	101
hen1-8 mee44	60	3,435,030	17	35	87	175
Wt_d	1,526	7,517,450	203	406	1,015	2,030
Col_d	164	11,692,099	14	28	70	140

Link to FindMiRNA for this sequence