Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCTCACTCTCTATCCGTCACC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w9,136,197Phasing windowAT5G26146w9,135,9139,138,264other RNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w9,136,197Phasing windowAT5G26147w9,136,1269,136,215MIR156F; miRNA
35w9,136,197Phasing windowath-MIR156fw9,136,1069,136,237miRNA
45w9,136,197Phasing windowAT5G26146w9,135,9139,138,264other RNA
55w9,136,197Phasing windowAT5G26147w9,136,1269,136,215MIR156F; miRNA
65w9,136,197Phasing windowath-MIR156fw9,136,1069,136,237miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F212,789,465  1124
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F253,822,319  13713
r2F102,195,923  0000
r2F222,233,522  1249
r2FSb85,728,276  13714
r2FNaSb25,311,047  1124
r2FNa121,834,656  12511
r2FNa246,081,068  1137
r2FL11,145,942  1249
r2FD74,928,142  13714
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC1473,743,342  132563126
r2SH42,165,395  24918
r2SNa152,082,930  251224
r2SC323,997,922  1135
r2SNa2294,617,795  6133163
r2SSb73,278,680  241121
r2SNaSb43,087,212  13613
r2SC298476,105  2064121,0292,058
r2SP9976,646  9184692
C0RC1401,249,181  3264160320
C0RNi101,211,490  8174183
AtCM214,488,208  1111
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-815,456,831  1112
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-144,328,718  1259
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-146,387,459  1136
hen1-8 r202,874,203  0000
hen1-8 heso1-116,015,054  1112
hen1-8 mee4403,435,030  0000
Wt_d37,517,450  1124
Col_d1911,692,099  23816


Link to FindMiRNA for this sequence