Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCTCACTCTCTTTTTGTCATAAC
Length: 23 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c3,456,665Phasing windowAT5G10945c3,456,6473,456,732MIR156D; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c3,456,665Phasing windowAT5G10946c3,455,6073,457,306
35c3,456,665Phasing windowath-MIR156dc3,456,6323,456,749miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F213,705,660  1113
d234F101,417,116  0000
d234F223,822,319  1135
r2F102,195,923  0000
r2F242,233,522  24918
r2FSb45,728,276  1137
r2FNaSb55,311,047  1259
r2FNa101,834,656  0000
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD34,928,142  1136
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC113,743,342  1113
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa204,617,795  0000
r2SSb53,278,680  23815
r2SNaSb13,087,212  1123
r2SC25476,105  112153105
r2SP0976,646  0000
C0RC121,249,181  23816
C0RNi21,211,490  23817
AtCM014,488,208  0000
AT_Leaf1398,047,907  173586173
At_miR1507OX_131,478,373  241020
At_miR1507OX_271,638,916  492143
At_miR2109OX_141,760,055  251123
At_miR2109OX_272,446,954  361429
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_281,258,140  6133264
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_231,733,586  23917
At_miR2118cOX_1181,995,522  9184590
At_miR2118cOX_232,496,180  12612
At_miROX_control21,838,508  12511
At_miROX_ck_221,804,409  12611
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-126,081,292  1123
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-1104,328,718  251223
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-138,736,008  1123
hen1-8 ntp10-116,387,459  1112
hen1-8 r212,874,203  1123
hen1-8 heso1-126,015,054  1123
hen1-8 mee4413,435,030  1113
Wt_d07,517,450  0000
Col_d5611,692,099  5102448


Link to FindMiRNA for this sequence