Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCTCACTGCTCTATCTGTCAGA
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14c15,415,447Phasing windowAT4G31877c15,413,31915,415,873MIR156C; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24c15,415,447Phasing windowath-MIR156cc15,415,41815,415,521miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F164,877,516  12612
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F131,417,116  241121
d234F253,822,319  13713
r2F1182,195,923  8164182
r2F272,233,522  361631
r2FSb595,728,276  102151103
r2FNaSb415,311,047  8153977
r2FNa161,834,656  371633
r2FNa2346,081,068  6112856
r2FL61,145,942  5102652
r2FD344,928,142  7143469
C0FCSb49,399,678  1124
C0FSb49,361,008  1124
r2SC13343,743,342  89178446892
r2SH2,0672,165,395  9551,9094,7739,546
r2SNa1322,082,930  153177154
r2SC32633,997,922  66132329658
r2SNa23364,617,795  73146364728
r2SSb1,1583,278,680  3537061,7663,532
r2SNaSb1933,087,212  63125313625
r2SC2149476,105  3136261,5653,130
r2SP14976,646  142972143
C0RC1331,249,181  2653132264
C0RNi131,211,490  112154107
AtCM17714,488,208  122461122
AT_Leaf1298,047,907  163280160
At_miR1507OX_181,478,373  5112754
At_miR1507OX_281,638,916  5102449
At_miR2109OX_161,760,055  371734
At_miR2109OX_292,446,954  471837
At_miR2118aOX_131,212,493  251225
At_miR2118aOX_2101,258,140  8164079
At_miR2118bOX_142,023,619  241020
At_miR2118bOX_281,733,586  592346
At_miR2118cOX_1121,995,522  6123060
At_miR2118cOX_252,496,180  241020
At_miROX_control51,838,508  351427
At_miROX_ck_251,804,409  361428
hen1-825,456,831  1124
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-114,328,718  1112
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d57,517,450  1137
Col_d211,692,099  1112


Link to FindMiRNA for this sequence