Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GCTCACTGCTCTTTCTGTCAGA
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	c	10,676,491	Phasing window	AT2G25095	c	10,676,472	10,676,553	MIR156A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	c	10,676,491	Phasing window	ath-MIR156a	c	10,676,451	10,676,573	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	2	4,877,516	1	1	2	4
C0F2	0	2,789,465	0	0	0	0
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	0	1,417,116	0	0	0	0
d234F2	4	3,822,319	1	2	5	10
r2F1	3	2,195,923	1	3	7	14
r2F2	1	2,233,522	1	1	2	4
r2FSb	34	5,728,276	6	12	30	59
r2FNaSb	12	5,311,047	2	5	11	23
r2FNa1	2	1,834,656	1	2	5	11
r2FNa2	10	6,081,068	2	3	8	16
r2FL	0	1,145,942	0	0	0	0
r2FD	18	4,928,142	4	7	18	37
C0FCSb	3	9,399,678	1	1	2	3
C0FSb	2	9,361,008	1	1	1	2
r2SC1	92	3,743,342	25	49	123	246
r2SH	348	2,165,395	161	321	804	1,607
r2SNa1	10	2,082,930	5	10	24	48
r2SC3	59	3,997,922	15	30	74	148
r2SNa2	95	4,617,795	21	41	103	206
r2SSb	270	3,278,680	82	165	412	824
r2SNaSb	31	3,087,212	10	20	50	100
r2SC2	65	476,105	137	273	683	1,365
r2SP	14	976,646	14	29	72	143
C0RC1	67	1,249,181	54	107	268	536
C0RNi	39	1,211,490	32	64	161	322
AtCM	50	14,488,208	3	7	17	35
AT_Leaf	2	8,047,907	1	1	1	2
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	1	2,446,954	1	1	2	4
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	0	5,456,831	0	0	0	0
hen1-8 ntp2-1	1	6,244,400	1	1	1	2
hen1-8 urt1-1	0	6,081,292	0	0	0	0
hen1-8 ntp4-1	0	4,626,878	0	0	0	0
hen1-8 ntp5-1	1	5,676,073	1	1	1	2
hen1-8 ntp6-1	2	4,328,718	1	1	2	5
hen1-8 ntp7-1	0	4,409,080	0	0	0	0
hen1-8 ntp8-1	0	8,736,008	0	0	0	0
hen1-8 ntp10-1	1	6,387,459	1	1	1	2
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	10	7,517,450	1	3	7	13
Col_d	4	11,692,099	1	1	2	3

Link to FindMiRNA for this sequence