Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GCTCTCTATACTTCTGTCACC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	c	6,244,547	Phasing window	AT3G18217	c	6,244,529	6,244,693	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	c	6,244,547	Phasing window	ath-MIR157c	c	6,244,500	6,244,716	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	0	4,877,516	0	0	0	0
C0F2	3	2,789,465	1	2	5	11
d1F1	0	3,574,742	0	0	0	0
d1F2	1	3,705,660	1	1	1	3
d234F1	1	1,417,116	1	1	4	7
d234F2	1	3,822,319	1	1	1	3
r2F1	4	2,195,923	2	4	9	18
r2F2	6	2,233,522	3	5	13	27
r2FSb	18	5,728,276	3	6	16	31
r2FNaSb	14	5,311,047	3	5	13	26
r2FNa1	4	1,834,656	2	4	11	22
r2FNa2	1	6,081,068	1	1	1	2
r2FL	2	1,145,942	2	3	9	17
r2FD	5	4,928,142	1	2	5	10
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	0	9,361,008	0	0	0	0
r2SC1	24	3,743,342	6	13	32	64
r2SH	9	2,165,395	4	8	21	42
r2SNa1	5	2,082,930	2	5	12	24
r2SC3	9	3,997,922	2	5	11	23
r2SNa2	57	4,617,795	12	25	62	123
r2SSb	20	3,278,680	6	12	31	61
r2SNaSb	13	3,087,212	4	8	21	42
r2SC2	155	476,105	326	651	1,628	3,256
r2SP	7	976,646	7	14	36	72
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	456	14,488,208	31	63	157	315
AT_Leaf	1,621	8,047,907	201	403	1,007	2,014
At_miR1507OX_1	138	1,478,373	93	187	467	933
At_miR1507OX_2	300	1,638,916	183	366	915	1,830
At_miR2109OX_1	199	1,760,055	113	226	565	1,131
At_miR2109OX_2	289	2,446,954	118	236	591	1,181
At_miR2118aOX_1	120	1,212,493	99	198	495	990
At_miR2118aOX_2	289	1,258,140	230	459	1,149	2,297
At_miR2118bOX_1	127	2,023,619	63	126	314	628
At_miR2118bOX_2	125	1,733,586	72	144	361	721
At_miR2118cOX_1	576	1,995,522	289	577	1,443	2,886
At_miR2118cOX_2	204	2,496,180	82	163	409	817
At_miROX_control	77	1,838,508	42	84	209	419
At_miROX_ck_2	103	1,804,409	57	114	285	571
hen1-8	70	5,456,831	13	26	64	128
hen1-8 ntp2-1	57	6,244,400	9	18	46	91
hen1-8 urt1-1	66	6,081,292	11	22	54	109
hen1-8 ntp4-1	83	4,626,878	18	36	90	179
hen1-8 ntp5-1	91	5,676,073	16	32	80	160
hen1-8 ntp6-1	382	4,328,718	88	176	441	882
hen1-8 ntp7-1	44	4,409,080	10	20	50	100
hen1-8 ntp8-1	112	8,736,008	13	26	64	128
hen1-8 ntp10-1	56	6,387,459	9	18	44	88
hen1-8 r2	11	2,874,203	4	8	19	38
hen1-8 heso1-1	22	6,015,054	4	7	18	37
hen1-8 mee44	20	3,435,030	6	12	29	58
Wt_d	2	7,517,450	1	1	1	3
Col_d	176	11,692,099	15	30	75	151

Link to FindMiRNA for this sequence