Arabidopsis small RNA Signature Analysis
The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.
Sequence: GGAATCTTGATGATGCTGCAT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1
| # | Chr | Strand | Coordinate | Phasing Analysis | Gene | Gene strand | Gene start | Gene stop | Gene function |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 5 | w | 23,988,566 | Phasing window | AT5G59505 | w | 23,988,472 | 23,988,596 | MIR172E; miRNA |
Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.
| # | Chr | Strand | Coordinate | Phasing Analysis | Gene | Gene strand | Gene start | Gene stop | Gene function |
|---|---|---|---|---|---|---|---|---|---|
| 2 | 5 | w | 23,988,566 | Phasing window | ath-MIR172e | w | 23,988,472 | 23,988,596 | miRNA |
SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.
| Raw Data | Normalization Denominator | ||||||
|---|---|---|---|---|---|---|---|
| Data type | Raw | Total | 1M | 2M | 5M | 10M | C0F1 | 1,421 | 4,877,516 | 291 | 583 | 1,457 | 2,913 | C0F2 | 17 | 2,789,465 | 6 | 12 | 30 | 61 | d1F1 | 128 | 3,574,742 | 36 | 72 | 179 | 358 | d1F2 | 11 | 3,705,660 | 3 | 6 | 15 | 30 | d234F1 | 1,664 | 1,417,116 | 1,174 | 2,348 | 5,871 | 11,742 | d234F2 | 169 | 3,822,319 | 44 | 88 | 221 | 442 | r2F1 | 3,628 | 2,195,923 | 1,652 | 3,304 | 8,261 | 16,522 | r2F2 | 837 | 2,233,522 | 375 | 749 | 1,874 | 3,747 | r2FSb | 23,997 | 5,728,276 | 4,189 | 8,378 | 20,946 | 41,892 | r2FNaSb | 7,063 | 5,311,047 | 1,330 | 2,660 | 6,649 | 13,299 | r2FNa1 | 3,206 | 1,834,656 | 1,747 | 3,495 | 8,737 | 17,475 | r2FNa2 | 6,223 | 6,081,068 | 1,023 | 2,047 | 5,117 | 10,233 | r2FL | 3,800 | 1,145,942 | 3,316 | 6,632 | 16,580 | 33,160 | r2FD | 6,220 | 4,928,142 | 1,262 | 2,524 | 6,311 | 12,621 | C0FCSb | 428 | 9,399,678 | 46 | 91 | 228 | 455 | C0FSb | 1,308 | 9,361,008 | 140 | 279 | 699 | 1,397 | r2SC1 | 78 | 3,743,342 | 21 | 42 | 104 | 208 | r2SH | 484 | 2,165,395 | 224 | 447 | 1,118 | 2,235 | r2SNa1 | 27 | 2,082,930 | 13 | 26 | 65 | 130 | r2SC3 | 143 | 3,997,922 | 36 | 72 | 179 | 358 | r2SNa2 | 424 | 4,617,795 | 92 | 184 | 459 | 918 | r2SSb | 279 | 3,278,680 | 85 | 170 | 425 | 851 | r2SNaSb | 273 | 3,087,212 | 88 | 177 | 442 | 884 | r2SC2 | 41 | 476,105 | 86 | 172 | 431 | 861 | r2SP | 543 | 976,646 | 556 | 1,112 | 2,780 | 5,560 | C0RC1 | 5,481 | 1,249,181 | 4,388 | 8,775 | 21,938 | 43,877 | C0RNi | 4,622 | 1,211,490 | 3,815 | 7,630 | 19,076 | 38,151 | AtCM | 46,785 | 14,488,208 | 3,229 | 6,458 | 16,146 | 32,292 | AT_Leaf | 10 | 8,047,907 | 1 | 2 | 6 | 12 | At_miR1507OX_1 | 3 | 1,478,373 | 2 | 4 | 10 | 20 | At_miR1507OX_2 | 1 | 1,638,916 | 1 | 1 | 3 | 6 | At_miR2109OX_1 | 0 | 1,760,055 | 0 | 0 | 0 | 0 | At_miR2109OX_2 | 1 | 2,446,954 | 1 | 1 | 2 | 4 | At_miR2118aOX_1 | 3 | 1,212,493 | 2 | 5 | 12 | 25 | At_miR2118aOX_2 | 0 | 1,258,140 | 0 | 0 | 0 | 0 | At_miR2118bOX_1 | 0 | 2,023,619 | 0 | 0 | 0 | 0 | At_miR2118bOX_2 | 1 | 1,733,586 | 1 | 1 | 3 | 6 | At_miR2118cOX_1 | 3 | 1,995,522 | 2 | 3 | 8 | 15 | At_miR2118cOX_2 | 4 | 2,496,180 | 2 | 3 | 8 | 16 | At_miROX_control | 3 | 1,838,508 | 2 | 3 | 8 | 16 | At_miROX_ck_2 | 1 | 1,804,409 | 1 | 1 | 3 | 6 | hen1-8 | 0 | 5,456,831 | 0 | 0 | 0 | 0 | hen1-8 ntp2-1 | 1 | 6,244,400 | 1 | 1 | 1 | 2 | hen1-8 urt1-1 | 0 | 6,081,292 | 0 | 0 | 0 | 0 | hen1-8 ntp4-1 | 0 | 4,626,878 | 0 | 0 | 0 | 0 | hen1-8 ntp5-1 | 1 | 5,676,073 | 1 | 1 | 1 | 2 | hen1-8 ntp6-1 | 12 | 4,328,718 | 3 | 6 | 14 | 28 | hen1-8 ntp7-1 | 0 | 4,409,080 | 0 | 0 | 0 | 0 | hen1-8 ntp8-1 | 1 | 8,736,008 | 1 | 1 | 1 | 1 | hen1-8 ntp10-1 | 0 | 6,387,459 | 0 | 0 | 0 | 0 | hen1-8 r2 | 0 | 2,874,203 | 0 | 0 | 0 | 0 | hen1-8 heso1-1 | 3 | 6,015,054 | 1 | 1 | 2 | 5 | hen1-8 mee44 | 0 | 3,435,030 | 0 | 0 | 0 | 0 | Wt_d | 2,564 | 7,517,450 | 341 | 682 | 1,705 | 3,411 | Col_d | 15 | 11,692,099 | 1 | 3 | 6 | 13 |