Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GGAATGTTGTCTGGATCGAGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	c	79,030	Phasing window	AT1G01183	c	78,932	79,032	MIR165/MIR165A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	c	79,030	Phasing window	ath-MIR165a	c	78,927	79,037	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	70	4,877,516	14	29	72	144
C0F2	0	2,789,465	0	0	0	0
d1F1	20	3,574,742	6	11	28	56
d1F2	20	3,705,660	5	11	27	54
d234F1	24	1,417,116	17	34	85	169
d234F2	113	3,822,319	30	59	148	296
r2F1	140	2,195,923	64	128	319	638
r2F2	72	2,233,522	32	64	161	322
r2FSb	281	5,728,276	49	98	245	491
r2FNaSb	182	5,311,047	34	69	171	343
r2FNa1	137	1,834,656	75	149	373	747
r2FNa2	485	6,081,068	80	160	399	798
r2FL	27	1,145,942	24	47	118	236
r2FD	493	4,928,142	100	200	500	1,000
C0FCSb	55	9,399,678	6	12	29	59
C0FSb	51	9,361,008	5	11	27	54
r2SC1	40	3,743,342	11	21	53	107
r2SH	4	2,165,395	2	4	9	18
r2SNa1	1	2,082,930	1	1	2	5
r2SC3	255	3,997,922	64	128	319	638
r2SNa2	305	4,617,795	66	132	330	660
r2SSb	633	3,278,680	193	386	965	1,931
r2SNaSb	81	3,087,212	26	52	131	262
r2SC2	306	476,105	643	1,285	3,214	6,427
r2SP	26	976,646	27	53	133	266
C0RC1	94	1,249,181	75	150	376	752
C0RNi	223	1,211,490	184	368	920	1,841
AtCM	290	14,488,208	20	40	100	200
AT_Leaf	848	8,047,907	105	211	527	1,054
At_miR1507OX_1	10	1,478,373	7	14	34	68
At_miR1507OX_2	26	1,638,916	16	32	79	159
At_miR2109OX_1	24	1,760,055	14	27	68	136
At_miR2109OX_2	25	2,446,954	10	20	51	102
At_miR2118aOX_1	9	1,212,493	7	15	37	74
At_miR2118aOX_2	17	1,258,140	14	27	68	135
At_miR2118bOX_1	22	2,023,619	11	22	54	109
At_miR2118bOX_2	25	1,733,586	14	29	72	144
At_miR2118cOX_1	23	1,995,522	12	23	58	115
At_miR2118cOX_2	15	2,496,180	6	12	30	60
At_miROX_control	33	1,838,508	18	36	90	179
At_miROX_ck_2	46	1,804,409	25	51	127	255
hen1-8	175	5,456,831	32	64	160	321
hen1-8 ntp2-1	174	6,244,400	28	56	139	279
hen1-8 urt1-1	108	6,081,292	18	36	89	178
hen1-8 ntp4-1	139	4,626,878	30	60	150	300
hen1-8 ntp5-1	216	5,676,073	38	76	190	381
hen1-8 ntp6-1	1,258	4,328,718	291	581	1,453	2,906
hen1-8 ntp7-1	74	4,409,080	17	34	84	168
hen1-8 ntp8-1	250	8,736,008	29	57	143	286
hen1-8 ntp10-1	176	6,387,459	28	55	138	276
hen1-8 r2	28	2,874,203	10	19	49	97
hen1-8 heso1-1	64	6,015,054	11	21	53	106
hen1-8 mee44	58	3,435,030	17	34	84	169
Wt_d	29	7,517,450	4	8	19	39
Col_d	183	11,692,099	16	31	78	157

Link to FindMiRNA for this sequence