Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GGAATGTTGTCTGGCACGAGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	c	16,775,656	Phasing window	AT5G41905	c	16,775,524	16,775,658	MIR166/MIR166E; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	c	16,775,656	Phasing window	ath-MIR166e	c	16,775,520	16,775,662	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	59	4,877,516	12	24	60	121
C0F2	1	2,789,465	1	1	2	4
d1F1	8	3,574,742	2	4	11	22
d1F2	7	3,705,660	2	4	9	19
d234F1	14	1,417,116	10	20	49	99
d234F2	69	3,822,319	18	36	90	181
r2F1	165	2,195,923	75	150	376	751
r2F2	14	2,233,522	6	13	31	63
r2FSb	557	5,728,276	97	194	486	972
r2FNaSb	230	5,311,047	43	87	217	433
r2FNa1	170	1,834,656	93	185	463	927
r2FNa2	326	6,081,068	54	107	268	536
r2FL	145	1,145,942	127	253	633	1,265
r2FD	477	4,928,142	97	194	484	968
C0FCSb	29	9,399,678	3	6	15	31
C0FSb	34	9,361,008	4	7	18	36
r2SC1	142	3,743,342	38	76	190	379
r2SH	32	2,165,395	15	30	74	148
r2SNa1	22	2,082,930	11	21	53	106
r2SC3	358	3,997,922	90	179	448	895
r2SNa2	1,121	4,617,795	243	486	1,214	2,428
r2SSb	1,219	3,278,680	372	744	1,859	3,718
r2SNaSb	275	3,087,212	89	178	445	891
r2SC2	8	476,105	17	34	84	168
r2SP	17	976,646	17	35	87	174
C0RC1	1	1,249,181	1	2	4	8
C0RNi	4	1,211,490	3	7	17	33
AtCM	132	14,488,208	9	18	46	91
AT_Leaf	4,457	8,047,907	554	1,108	2,769	5,538
At_miR1507OX_1	19	1,478,373	13	26	64	129
At_miR1507OX_2	17	1,638,916	10	21	52	104
At_miR2109OX_1	7	1,760,055	4	8	20	40
At_miR2109OX_2	18	2,446,954	7	15	37	74
At_miR2118aOX_1	10	1,212,493	8	16	41	82
At_miR2118aOX_2	11	1,258,140	9	17	44	87
At_miR2118bOX_1	15	2,023,619	7	15	37	74
At_miR2118bOX_2	10	1,733,586	6	12	29	58
At_miR2118cOX_1	35	1,995,522	18	35	88	175
At_miR2118cOX_2	20	2,496,180	8	16	40	80
At_miROX_control	11	1,838,508	6	12	30	60
At_miROX_ck_2	4	1,804,409	2	4	11	22
hen1-8	9	5,456,831	2	3	8	16
hen1-8 ntp2-1	6	6,244,400	1	2	5	10
hen1-8 urt1-1	12	6,081,292	2	4	10	20
hen1-8 ntp4-1	10	4,626,878	2	4	11	22
hen1-8 ntp5-1	9	5,676,073	2	3	8	16
hen1-8 ntp6-1	112	4,328,718	26	52	129	259
hen1-8 ntp7-1	7	4,409,080	2	3	8	16
hen1-8 ntp8-1	5	8,736,008	1	1	3	6
hen1-8 ntp10-1	13	6,387,459	2	4	10	20
hen1-8 r2	2	2,874,203	1	1	3	7
hen1-8 heso1-1	1	6,015,054	1	1	1	2
hen1-8 mee44	2	3,435,030	1	1	3	6
Wt_d	19	7,517,450	3	5	13	25
Col_d	8	11,692,099	1	1	3	7

Link to FindMiRNA for this sequence