Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GGCAAGTTGTCCTTCGGCTACA
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w8,527,592Phasing windowAT5G24825w8,527,4698,527,649MIR169B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w8,527,592Phasing windowath-MIR169bw8,527,4698,527,649miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F2113,822,319  361429
r2F122,195,923  1259
r2F252,233,522  241122
r2FSb765,728,276  132766133
r2FNaSb115,311,047  241021
r2FNa111,834,656  1135
r2FNa256,081,068  1248
r2FL21,145,942  23917
r2FD94,928,142  24918
C0FCSb39,399,678  1123
C0FSb59,361,008  1135
r2SC1143,743,342  471937
r2SH422,165,395  193997194
r2SNa102,082,930  0000
r2SC333,997,922  1248
r2SNa2304,617,795  6133265
r2SSb303,278,680  9184692
r2SNaSb03,087,212  0000
r2SC26476,105  132563126
r2SP2976,646  241020
C0RC1191,249,181  153076152
C0RNi261,211,490  2143107215
AtCM814,488,208  1136
AT_Leaf2,1308,047,907  2655291,3232,647
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d17,517,450  1111
Col_d211,692,099  1112


Link to FindMiRNA for this sequence