Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GGCAAGTTGTCCTTGGCTAC
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c4,359,030Phasing windowAT3G13405c4,359,0124,359,202miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23c4,359,030Phasing windowath-MIR169ac4,358,9944,359,219miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1134,877,516  351327
C0F202,789,465  0000
d1F113,574,742  1113
d1F203,705,660  0000
d234F181,417,116  6112856
d234F263,822,319  23816
r2F1332,195,923  153075150
r2F2132,233,522  6122958
r2FSb495,728,276  9174386
r2FNaSb385,311,047  7143672
r2FNa1451,834,656  2549123245
r2FNa2136,081,068  241121
r2FL291,145,942  2551127253
r2FD1204,928,142  2449122243
C0FCSb09,399,678  0000
C0FSb39,361,008  1123
r2SC1113,743,342  361529
r2SH1,2632,165,395  5831,1672,9165,833
r2SNa102,082,930  0000
r2SC3203,997,922  5102550
r2SNa21134,617,795  2449122245
r2SSb2523,278,680  77154384769
r2SNaSb893,087,212  2958144288
r2SC28476,105  173484168
r2SP14976,646  142972143
C0RC1261,249,181  2142104208
C0RNi231,211,490  193895190
AtCM72714,488,208  50100251502
AT_Leaf98,047,907  12611
At_miR1507OX_1121,478,373  8164181
At_miR1507OX_281,638,916  5102449
At_miR2109OX_131,760,055  23917
At_miR2109OX_2102,446,954  482041
At_miR2118aOX_151,212,493  482141
At_miR2118aOX_291,258,140  7143672
At_miR2118bOX_132,023,619  13715
At_miR2118bOX_261,733,586  371735
At_miR2118cOX_1151,995,522  8153875
At_miR2118cOX_272,496,180  361428
At_miROX_control31,838,508  23816
At_miROX_ck_231,804,409  23817
hen1-885,456,831  13715
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-176,081,292  12612
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-145,676,073  1147
hen1-8 ntp6-1164,328,718  471837
hen1-8 ntp7-134,409,080  1137
hen1-8 ntp8-148,736,008  1125
hen1-8 ntp10-166,387,459  1259
hen1-8 r232,874,203  12510
hen1-8 heso1-156,015,054  1248
hen1-8 mee4443,435,030  12612
Wt_d287,517,450  471937
Col_d111,692,099  1111


Link to FindMiRNA for this sequence