Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GGGCATCTTTCTATTGGCAGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w24,962,497Phasing windowAT5G62162w24,962,48524,962,598MIR399C; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w24,962,497Phasing windowath-MIR399cw24,962,48524,962,598miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb45,311,047  1248
r2FNa111,834,656  1135
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD14,928,142  1112
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC193,743,342  251224
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa274,617,795  23815
r2SSb273,278,680  8164182
r2SNaSb23,087,212  1136
r2SC22476,105  482142
r2SP578976,646  5921,1842,9595,918
C0RC111,249,181  1248
C0RNi41,211,490  371733
AtCM014,488,208  0000
AT_Leaf2098,047,907  2652130260
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_121,760,055  12611
At_miR2109OX_232,446,954  12612
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_232,496,180  12612
At_miROX_control11,838,508  1135
At_miROX_ck_211,804,409  1136
hen1-815,456,831  1112
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-156,081,292  1248
hen1-8 ntp4-154,626,878  12511
hen1-8 ntp5-155,676,073  1249
hen1-8 ntp6-1434,328,718  10205099
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-158,736,008  1136
hen1-8 ntp10-146,387,459  1136
hen1-8 r242,874,203  13714
hen1-8 heso1-136,015,054  1125
hen1-8 mee4433,435,030  1249
Wt_d07,517,450  0000
Col_d011,692,099  0000


Link to FindMiRNA for this sequence