Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GTCCTCGGGATGCGGATTACC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	w	2,854,394	Phasing window	AT3G09285	w	2,854,280	2,854,449	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	w	2,854,394	Phasing window	ath-MIR2111a	w	2,854,284	2,854,442	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	14	4,877,516	3	6	14	29
C0F2	5	2,789,465	2	4	9	18
d1F1	1	3,574,742	1	1	1	3
d1F2	0	3,705,660	0	0	0	0
d234F1	18	1,417,116	13	25	64	127
d234F2	32	3,822,319	8	17	42	84
r2F1	92	2,195,923	42	84	209	419
r2F2	8	2,233,522	4	7	18	36
r2FSb	329	5,728,276	57	115	287	574
r2FNaSb	139	5,311,047	26	52	131	262
r2FNa1	65	1,834,656	35	71	177	354
r2FNa2	296	6,081,068	49	97	243	487
r2FL	18	1,145,942	16	31	79	157
r2FD	263	4,928,142	53	107	267	534
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	4	9,361,008	1	1	2	4
r2SC1	66	3,743,342	18	35	88	176
r2SH	15	2,165,395	7	14	35	69
r2SNa1	5	2,082,930	2	5	12	24
r2SC3	83	3,997,922	21	42	104	208
r2SNa2	394	4,617,795	85	171	427	853
r2SSb	528	3,278,680	161	322	805	1,610
r2SNaSb	155	3,087,212	50	100	251	502
r2SC2	24	476,105	50	101	252	504
r2SP	13,296	976,646	13,614	27,228	68,070	136,139
C0RC1	29	1,249,181	23	46	116	232
C0RNi	39	1,211,490	32	64	161	322
AtCM	2	14,488,208	1	1	1	1
AT_Leaf	0	8,047,907	0	0	0	0
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	0	2,446,954	0	0	0	0
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	8	5,456,831	1	3	7	15
hen1-8 ntp2-1	3	6,244,400	1	1	2	5
hen1-8 urt1-1	6	6,081,292	1	2	5	10
hen1-8 ntp4-1	4	4,626,878	1	2	4	9
hen1-8 ntp5-1	6	5,676,073	1	2	5	11
hen1-8 ntp6-1	29	4,328,718	7	13	33	67
hen1-8 ntp7-1	1	4,409,080	1	1	1	2
hen1-8 ntp8-1	4	8,736,008	1	1	2	5
hen1-8 ntp10-1	6	6,387,459	1	2	5	9
hen1-8 r2	1	2,874,203	1	1	2	3
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	7	3,435,030	2	4	10	20
Wt_d	8	7,517,450	1	2	5	11
Col_d	4	11,692,099	1	1	2	3

Link to FindMiRNA for this sequence