Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: GTTCAATAAAGCTGTGGGAAG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	c	4,142,351	Phasing window	AT2G10606	c	4,142,323	4,142,473	MIR396A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	c	4,142,351	Phasing window	ath-MIR396a	c	4,142,323	4,142,473	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	24	4,877,516	5	10	25	49
C0F2	7	2,789,465	3	5	13	25
d1F1	10	3,574,742	3	6	14	28
d1F2	27	3,705,660	7	15	36	73
d234F1	28	1,417,116	20	40	99	198
d234F2	86	3,822,319	22	45	112	225
r2F1	66	2,195,923	30	60	150	301
r2F2	133	2,233,522	60	119	298	595
r2FSb	204	5,728,276	36	71	178	356
r2FNaSb	164	5,311,047	31	62	154	309
r2FNa1	108	1,834,656	59	118	294	589
r2FNa2	153	6,081,068	25	50	126	252
r2FL	90	1,145,942	79	157	393	785
r2FD	148	4,928,142	30	60	150	300
C0FCSb	10	9,399,678	1	2	5	11
C0FSb	42	9,361,008	4	9	22	45
r2SC1	47	3,743,342	13	25	63	126
r2SH	19	2,165,395	9	18	44	88
r2SNa1	12	2,082,930	6	12	29	58
r2SC3	99	3,997,922	25	50	124	248
r2SNa2	275	4,617,795	60	119	298	596
r2SSb	126	3,278,680	38	77	192	384
r2SNaSb	75	3,087,212	24	49	121	243
r2SC2	1	476,105	2	4	11	21
r2SP	15	976,646	15	31	77	154
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	9	14,488,208	1	1	3	6
AT_Leaf	51,277	8,047,907	6,371	12,743	31,857	63,715
At_miR1507OX_1	193	1,478,373	131	261	653	1,305
At_miR1507OX_2	295	1,638,916	180	360	900	1,800
At_miR2109OX_1	132	1,760,055	75	150	375	750
At_miR2109OX_2	232	2,446,954	95	190	474	948
At_miR2118aOX_1	69	1,212,493	57	114	285	569
At_miR2118aOX_2	151	1,258,140	120	240	600	1,200
At_miR2118bOX_1	243	2,023,619	120	240	600	1,201
At_miR2118bOX_2	193	1,733,586	111	223	557	1,113
At_miR2118cOX_1	252	1,995,522	126	253	631	1,263
At_miR2118cOX_2	191	2,496,180	77	153	383	765
At_miROX_control	193	1,838,508	105	210	525	1,050
At_miROX_ck_2	252	1,804,409	140	279	698	1,397
hen1-8	250	5,456,831	46	92	229	458
hen1-8 ntp2-1	196	6,244,400	31	63	157	314
hen1-8 urt1-1	273	6,081,292	45	90	224	449
hen1-8 ntp4-1	290	4,626,878	63	125	313	627
hen1-8 ntp5-1	708	5,676,073	125	249	624	1,247
hen1-8 ntp6-1	5,854	4,328,718	1,352	2,705	6,762	13,524
hen1-8 ntp7-1	202	4,409,080	46	92	229	458
hen1-8 ntp8-1	338	8,736,008	39	77	193	387
hen1-8 ntp10-1	323	6,387,459	51	101	253	506
hen1-8 r2	77	2,874,203	27	54	134	268
hen1-8 heso1-1	244	6,015,054	41	81	203	406
hen1-8 mee44	157	3,435,030	46	91	229	457
Wt_d	58	7,517,450	8	15	39	77
Col_d	174	11,692,099	15	30	74	149

Link to FindMiRNA for this sequence