Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TAAAGTCAATAATACCTTGAAG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w6,740,569Phasing windowAT1G19464w6,740,5006,740,591MIR864a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w6,740,569Phasing windowath-MIR864w6,740,5006,740,591miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F223,822,319  1135
r2F102,195,923  0000
r2F222,233,522  1249
r2FSb25,728,276  1123
r2FNaSb15,311,047  1112
r2FNa121,834,656  12511
r2FNa216,081,068  1112
r2FL01,145,942  0000
r2FD34,928,142  1136
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa214,617,795  1112
r2SSb03,278,680  0000
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC121,249,181  23816
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf08,047,907  0000
At_miR1507OX_111,478,373  1137
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_222,446,954  1248
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_231,258,140  251224
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_131,995,522  23815
At_miR2118cOX_212,496,180  1124
At_miROX_control11,838,508  1135
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-126,387,459  1123
hen1-8 r212,874,203  1123
hen1-8 heso1-106,015,054  0000
hen1-8 mee4413,435,030  1113
Wt_d147,517,450  24919
Col_d611,692,099  1135


Link to FindMiRNA for this sequence