Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TAAGATCCGGACTACAACAAAG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14w7,845,756Phasing windowAT4G13493w7,845,7077,845,927MIR850a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24w7,845,756Phasing windowAT4G13495w7,842,9677,846,774other RNA
34w7,845,756Phasing windowath-MIR850w7,845,7077,845,927miRNA
44w7,845,756Phasing windowAT4G13493w7,845,7077,845,927MIR850a; miRNA
54w7,845,756Phasing windowAT4G13495w7,842,9677,846,774other RNA
64w7,845,756Phasing windowath-MIR850w7,845,7077,845,927miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F134,877,516  1136
C0F202,789,465  0000
d1F103,574,742  0000
d1F213,705,660  1113
d234F111,417,116  1147
d234F243,822,319  12510
r2F152,195,923  251123
r2F202,233,522  0000
r2FSb105,728,276  23917
r2FNaSb225,311,047  482141
r2FNa131,834,656  23816
r2FNa276,081,068  12612
r2FL31,145,942  351326
r2FD64,928,142  12612
C0FCSb39,399,678  1123
C0FSb29,361,008  1112
r2SC1103,743,342  351327
r2SH32,165,395  13714
r2SNa102,082,930  0000
r2SC3133,997,922  371633
r2SNa2814,617,795  183588175
r2SSb243,278,680  7153773
r2SNaSb53,087,212  23816
r2SC21476,105  241121
r2SP1976,646  12510
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf278,047,907  371734
At_miR1507OX_1111,478,373  7153774
At_miR1507OX_2211,638,916  132664128
At_miR2109OX_1121,760,055  7143468
At_miR2109OX_2182,446,954  7153774
At_miR2118aOX_141,212,493  371633
At_miR2118aOX_291,258,140  7143672
At_miR2118bOX_1192,023,619  9194794
At_miR2118bOX_271,733,586  482040
At_miR2118cOX_1181,995,522  9184590
At_miR2118cOX_2222,496,180  9184488
At_miROX_control151,838,508  8164182
At_miROX_ck_261,804,409  371733
hen1-8115,456,831  241020
hen1-8 ntp2-1246,244,400  481938
hen1-8 urt1-1176,081,292  361428
hen1-8 ntp4-1144,626,878  361530
hen1-8 ntp5-1215,676,073  471837
hen1-8 ntp6-11414,328,718  3365163326
hen1-8 ntp7-1184,409,080  482041
hen1-8 ntp8-1318,736,008  471835
hen1-8 ntp10-1116,387,459  23917
hen1-8 r232,874,203  12510
hen1-8 heso1-176,015,054  12612
hen1-8 mee4473,435,030  241020
Wt_d17,517,450  1111
Col_d2311,692,099  241020


Link to FindMiRNA for this sequence