Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TAAGCTGCCAGCATGATCTTG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c1,306,770Phasing windowAT3G04765c1,306,6221,306,781miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23c1,306,770Phasing windowath-MIR167cc1,306,6221,306,781miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F124,877,516  1124
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F213,822,319  1113
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb125,728,276  241021
r2FNaSb185,311,047  371734
r2FNa131,834,656  23816
r2FNa2106,081,068  23816
r2FL11,145,942  1249
r2FD114,928,142  241122
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC1193,743,342  5102551
r2SH82,165,395  471837
r2SNa112,082,930  1125
r2SC3453,997,922  112356113
r2SNa21134,617,795  2449122245
r2SSb973,278,680  3059148296
r2SNaSb343,087,212  112255110
r2SC218476,105  3876189378
r2SP341976,646  3496981,7463,492
C0RC15341,249,181  4278552,1374,275
C0RNi4921,211,490  4068122,0314,061
AtCM114,488,208  1111
AT_Leaf158,047,907  24919
At_miR1507OX_111,478,373  1137
At_miR1507OX_211,638,916  1136
At_miR2109OX_101,760,055  0000
At_miR2109OX_222,446,954  1248
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_221,733,586  12612
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_212,496,180  1124
At_miROX_control11,838,508  1135
At_miROX_ck_201,804,409  0000
hen1-815,456,831  1112
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-166,081,292  12510
hen1-8 ntp4-144,626,878  1249
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-144,328,718  1259
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-148,736,008  1125
hen1-8 ntp10-126,387,459  1123
hen1-8 r202,874,203  0000
hen1-8 heso1-136,015,054  1125
hen1-8 mee4403,435,030  0000
Wt_d27,517,450  1113
Col_d211,692,099  1112


Link to FindMiRNA for this sequence