Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TAAGTTAAGATTTGTGAAGAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w7,168,879Phasing windowAT5G21100w7,168,1847,170,928Plant L-ascorbate oxidase

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w7,168,879Phasing windowath-MIR1888w7,168,8707,168,969miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F134,877,516  1136
C0F212,789,465  1124
d1F133,574,742  1248
d1F243,705,660  12511
d234F131,417,116  241121
d234F2393,822,319  102051102
r2F1162,195,923  7153673
r2F21992,233,522  89178445891
r2FSb475,728,276  8164182
r2FNaSb215,311,047  482040
r2FNa121,834,656  12511
r2FNa2266,081,068  492143
r2FL21,145,942  23917
r2FD364,928,142  7153773
C0FCSb09,399,678  0000
C0FSb39,361,008  1123
r2SC163,743,342  23816
r2SH342,165,395  163179157
r2SNa132,082,930  13714
r2SC353,997,922  13613
r2SNa244,617,795  1249
r2SSb33,278,680  1259
r2SNaSb13,087,212  1123
r2SC29476,105  193895189
r2SP18976,646  183792184
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf1,8888,047,907  2354691,1732,346
At_miR1507OX_161,478,373  482041
At_miR1507OX_261,638,916  471837
At_miR2109OX_1121,760,055  7143468
At_miR2109OX_282,446,954  371633
At_miR2118aOX_161,212,493  5102549
At_miR2118aOX_2111,258,140  9174487
At_miR2118bOX_1112,023,619  5112754
At_miR2118bOX_251,733,586  361429
At_miR2118cOX_1111,995,522  6112855
At_miR2118cOX_2212,496,180  8174284
At_miROX_control81,838,508  492244
At_miROX_ck_2121,804,409  7133367
hen1-875,456,831  13613
hen1-8 ntp2-1116,244,400  24918
hen1-8 urt1-186,081,292  13713
hen1-8 ntp4-1124,626,878  351326
hen1-8 ntp5-1205,676,073  471835
hen1-8 ntp6-1424,328,718  10194997
hen1-8 ntp7-144,409,080  1259
hen1-8 ntp8-198,736,008  12510
hen1-8 ntp10-1126,387,459  24919
hen1-8 r2112,874,203  481938
hen1-8 heso1-136,015,054  1125
hen1-8 mee44173,435,030  5102549
Wt_d297,517,450  481939
Col_d1211,692,099  12510


Link to FindMiRNA for this sequence