Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TACCAACCTTTCATCGTTCCC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c25,279,158Phasing windowAT1G67481c25,278,94425,279,207MIR839a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c25,279,158Phasing windowath-MIR839c25,278,94425,279,207miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1114,877,516  251123
C0F2162,789,465  6112957
d1F153,574,742  13714
d1F2683,705,660  183792184
d234F101,417,116  0000
d234F203,822,319  0000
r2F1312,195,923  142871141
r2F2282,233,522  132563125
r2FSb3635,728,276  63127317634
r2FNaSb2195,311,047  4182206412
r2FNa1491,834,656  2753134267
r2FNa22866,081,068  4794235470
r2FL201,145,942  173587175
r2FD2214,928,142  4590224448
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC113,743,342  1113
r2SH32,165,395  13714
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa2104,617,795  241122
r2SSb33,278,680  1259
r2SNaSb23,087,212  1136
r2SC21476,105  241121
r2SP0976,646  0000
C0RC111,249,181  1248
C0RNi11,211,490  1248
AtCM214,488,208  1111
AT_Leaf28,047,907  1112
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_111,760,055  1136
At_miR2109OX_202,446,954  0000
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_131,995,522  23815
At_miR2118cOX_222,496,180  1248
At_miROX_control31,838,508  23816
At_miROX_ck_201,804,409  0000
hen1-85135,456,831  94188470940
hen1-8 ntp2-14286,244,400  69137343685
hen1-8 urt1-16976,081,292  1152295731,146
hen1-8 ntp4-14594,626,878  99198496992
hen1-8 ntp5-15465,676,073  96192481962
hen1-8 ntp6-11,4234,328,718  3296571,6443,287
hen1-8 ntp7-15044,409,080  1142295721,143
hen1-8 ntp8-11,0318,736,008  1182365901,180
hen1-8 ntp10-16006,387,459  94188470939
hen1-8 r23432,874,203  1192395971,193
hen1-8 heso1-15166,015,054  86172429858
hen1-8 mee443573,435,030  1042085201,039
Wt_d2257,517,450  3060150299
Col_d84411,692,099  72144361722


Link to FindMiRNA for this sequence