Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TACGAGCCACTGGAAACTGAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14w2,184,325Phasing windowAT4G04408c2,184,0592,184,400

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24w2,184,325Phasing windowath-MIR841bw2,184,1352,184,629miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F144,877,516  1248
C0F202,789,465  0000
d1F153,574,742  13714
d1F223,705,660  1135
d234F111,417,116  1147
d234F2123,822,319  361631
r2F1122,195,923  5112755
r2F252,233,522  241122
r2FSb325,728,276  6112856
r2FNaSb215,311,047  482040
r2FNa141,834,656  241122
r2FNa2116,081,068  24918
r2FL21,145,942  23917
r2FD134,928,142  351326
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC193,743,342  251224
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC3163,997,922  482040
r2SNa2324,617,795  7143569
r2SSb93,278,680  351427
r2SNaSb53,087,212  23816
r2SC21476,105  241121
r2SP5976,646  5102651
C0RC101,249,181  0000
C0RNi11,211,490  1248
AtCM714,488,208  1125
AT_Leaf568,047,907  7143570
At_miR1507OX_1141,478,373  9194795
At_miR1507OX_2201,638,916  122461122
At_miR2109OX_1251,760,055  142871142
At_miR2109OX_2502,446,954  2041102204
At_miR2118aOX_1241,212,493  204099198
At_miR2118aOX_2401,258,140  3264159318
At_miR2118bOX_1442,023,619  2243109217
At_miR2118bOX_2161,733,586  9184692
At_miR2118cOX_1651,995,522  3365163326
At_miR2118cOX_2532,496,180  2142106212
At_miROX_control181,838,508  10204998
At_miROX_ck_2451,804,409  2550125249
hen1-855,456,831  1259
hen1-8 ntp2-146,244,400  1136
hen1-8 urt1-196,081,292  13715
hen1-8 ntp4-174,626,878  23815
hen1-8 ntp5-1125,676,073  241121
hen1-8 ntp6-1494,328,718  112357113
hen1-8 ntp7-184,409,080  24918
hen1-8 ntp8-1128,736,008  13714
hen1-8 ntp10-146,387,459  1136
hen1-8 r212,874,203  1123
hen1-8 heso1-126,015,054  1123
hen1-8 mee4433,435,030  1249
Wt_d167,517,450  241121
Col_d5811,692,099  5102550


Link to FindMiRNA for this sequence