Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TACGAGCCACTTGAAACTGAA
Length: 21 nucleotides
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	c	7,885,413	Phasing window	AT4G13564	c	7,885,251	7,885,462	MIR841a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	c	7,885,413	Phasing window	AT4G13570	w	7,884,516	7,885,982	histone H2A 4
3	4	c	7,885,413	Phasing window	ath-MIR841	c	7,885,251	7,885,462	miRNA
4	4	c	7,885,413	Phasing window	AT4G13564	c	7,885,251	7,885,462	MIR841a; miRNA
5	4	c	7,885,413	Phasing window	AT4G13570	w	7,884,516	7,885,982	histone H2A 4
6	4	c	7,885,413	Phasing window	ath-MIR841	c	7,885,251	7,885,462	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1	4,877,516	1	1	1	2
C0F2	0	2,789,465	0	0	0	0
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	0	1,417,116	0	0	0	0
d234F2	6	3,822,319	2	3	8	16
r2F1	2	2,195,923	1	2	5	9
r2F2	0	2,233,522	0	0	0	0
r2FSb	5	5,728,276	1	2	4	9
r2FNaSb	5	5,311,047	1	2	5	9
r2FNa1	0	1,834,656	0	0	0	0
r2FNa2	1	6,081,068	1	1	1	2
r2FL	2	1,145,942	2	3	9	17
r2FD	3	4,928,142	1	1	3	6
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	1	9,361,008	1	1	1	1
r2SC1	72	3,743,342	19	38	96	192
r2SH	19	2,165,395	9	18	44	88
r2SNa1	28	2,082,930	13	27	67	134
r2SC3	68	3,997,922	17	34	85	170
r2SNa2	164	4,617,795	36	71	178	355
r2SSb	75	3,278,680	23	46	114	229
r2SNaSb	53	3,087,212	17	34	86	172
r2SC2	9	476,105	19	38	95	189
r2SP	2	976,646	2	4	10	20
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	1	14,488,208	1	1	1	1
AT_Leaf	281	8,047,907	35	70	175	349
At_miR1507OX_1	38	1,478,373	26	51	129	257
At_miR1507OX_2	150	1,638,916	92	183	458	915
At_miR2109OX_1	102	1,760,055	58	116	290	580
At_miR2109OX_2	175	2,446,954	72	143	358	715
At_miR2118aOX_1	51	1,212,493	42	84	210	421
At_miR2118aOX_2	118	1,258,140	94	188	469	938
At_miR2118bOX_1	183	2,023,619	90	181	452	904
At_miR2118bOX_2	68	1,733,586	39	78	196	392
At_miR2118cOX_1	134	1,995,522	67	134	336	672
At_miR2118cOX_2	117	2,496,180	47	94	234	469
At_miROX_control	133	1,838,508	72	145	362	723
At_miROX_ck_2	151	1,804,409	84	167	418	837
hen1-8	2	5,456,831	1	1	2	4
hen1-8 ntp2-1	0	6,244,400	0	0	0	0
hen1-8 urt1-1	1	6,081,292	1	1	1	2
hen1-8 ntp4-1	0	4,626,878	0	0	0	0
hen1-8 ntp5-1	3	5,676,073	1	1	3	5
hen1-8 ntp6-1	1	4,328,718	1	1	1	2
hen1-8 ntp7-1	1	4,409,080	1	1	1	2
hen1-8 ntp8-1	0	8,736,008	0	0	0	0
hen1-8 ntp10-1	0	6,387,459	0	0	0	0
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	3	3,435,030	1	2	4	9
Wt_d	0	7,517,450	0	0	0	0
Col_d	5	11,692,099	1	1	2	4

Link to FindMiRNA for this sequence