Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TACGCATTGAGTTTCGTTGCTT
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	26,638,083	Phasing window	AT1G70645	w	26,638,000	26,638,107	MIR777a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	26,638,083	Phasing window	AT1G70650	w	26,638,075	26,642,268	Ran BP2/NZF zinc finger-like superfamily protein
3	1	w	26,638,083	Phasing window	ath-MIR777	w	26,638,000	26,638,107	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	70	4,877,516	14	29	72	144
C0F2	0	2,789,465	0	0	0	0
d1F1	14	3,574,742	4	8	20	39
d1F2	4	3,705,660	1	2	5	11
d234F1	48	1,417,116	34	68	169	339
d234F2	39	3,822,319	10	20	51	102
r2F1	247	2,195,923	112	225	562	1,125
r2F2	59	2,233,522	26	53	132	264
r2FSb	742	5,728,276	130	259	648	1,295
r2FNaSb	445	5,311,047	84	168	419	838
r2FNa1	257	1,834,656	140	280	700	1,401
r2FNa2	410	6,081,068	67	135	337	674
r2FL	160	1,145,942	140	279	698	1,396
r2FD	445	4,928,142	90	181	451	903
C0FCSb	26	9,399,678	3	6	14	28
C0FSb	29	9,361,008	3	6	15	31
r2SC1	22	3,743,342	6	12	29	59
r2SH	49	2,165,395	23	45	113	226
r2SNa1	7	2,082,930	3	7	17	34
r2SC3	23	3,997,922	6	12	29	58
r2SNa2	73	4,617,795	16	32	79	158
r2SSb	46	3,278,680	14	28	70	140
r2SNaSb	46	3,087,212	15	30	75	149
r2SC2	35	476,105	74	147	368	735
r2SP	247	976,646	253	506	1,265	2,529
C0RC1	256	1,249,181	205	410	1,025	2,049
C0RNi	154	1,211,490	127	254	636	1,271
AtCM	840	14,488,208	58	116	290	580
AT_Leaf	67	8,047,907	8	17	42	83
At_miR1507OX_1	14	1,478,373	9	19	47	95
At_miR1507OX_2	17	1,638,916	10	21	52	104
At_miR2109OX_1	9	1,760,055	5	10	26	51
At_miR2109OX_2	37	2,446,954	15	30	76	151
At_miR2118aOX_1	9	1,212,493	7	15	37	74
At_miR2118aOX_2	8	1,258,140	6	13	32	64
At_miR2118bOX_1	18	2,023,619	9	18	44	89
At_miR2118bOX_2	12	1,733,586	7	14	35	69
At_miR2118cOX_1	13	1,995,522	7	13	33	65
At_miR2118cOX_2	15	2,496,180	6	12	30	60
At_miROX_control	15	1,838,508	8	16	41	82
At_miROX_ck_2	16	1,804,409	9	18	44	89
hen1-8	5	5,456,831	1	2	5	9
hen1-8 ntp2-1	6	6,244,400	1	2	5	10
hen1-8 urt1-1	7	6,081,292	1	2	6	12
hen1-8 ntp4-1	3	4,626,878	1	1	3	6
hen1-8 ntp5-1	14	5,676,073	2	5	12	25
hen1-8 ntp6-1	99	4,328,718	23	46	114	229
hen1-8 ntp7-1	9	4,409,080	2	4	10	20
hen1-8 ntp8-1	12	8,736,008	1	3	7	14
hen1-8 ntp10-1	13	6,387,459	2	4	10	20
hen1-8 r2	5	2,874,203	2	3	9	17
hen1-8 heso1-1	15	6,015,054	2	5	12	25
hen1-8 mee44	5	3,435,030	1	3	7	15
Wt_d	619	7,517,450	82	165	412	823
Col_d	59	11,692,099	5	10	25	50

Link to FindMiRNA for this sequence