Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TATTGGCCTGGTTCACTCAGA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	w	19,073,452	Phasing window	AT3G51375	w	19,073,450	19,073,541	MIR171A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	w	19,073,452	Phasing window	ath-MIR171a	w	19,073,434	19,073,556	miRNA
3	5	c	26,411,655	Phasing window	AT5G66045	c	26,411,594	26,411,657	MIR170; miRNA
4	5	c	26,411,655	Phasing window	ath-MIR170	c	26,411,580	26,411,672	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	14	4,877,516	3	6	14	29
C0F2	0	2,789,465	0	0	0	0
d1F1	1	3,574,742	1	1	1	3
d1F2	0	3,705,660	0	0	0	0
d234F1	2	1,417,116	1	3	7	14
d234F2	5	3,822,319	1	3	7	13
r2F1	18	2,195,923	8	16	41	82
r2F2	47	2,233,522	21	42	105	210
r2FSb	198	5,728,276	35	69	173	346
r2FNaSb	182	5,311,047	34	69	171	343
r2FNa1	22	1,834,656	12	24	60	120
r2FNa2	258	6,081,068	42	85	212	424
r2FL	9	1,145,942	8	16	39	79
r2FD	82	4,928,142	17	33	83	166
C0FCSb	2	9,399,678	1	1	1	2
C0FSb	24	9,361,008	3	5	13	26
r2SC1	13	3,743,342	3	7	17	35
r2SH	0	2,165,395	0	0	0	0
r2SNa1	2	2,082,930	1	2	5	10
r2SC3	26	3,997,922	7	13	33	65
r2SNa2	26	4,617,795	6	11	28	56
r2SSb	33	3,278,680	10	20	50	101
r2SNaSb	13	3,087,212	4	8	21	42
r2SC2	30	476,105	63	126	315	630
r2SP	9	976,646	9	18	46	92
C0RC1	0	1,249,181	0	0	0	0
C0RNi	1	1,211,490	1	2	4	8
AtCM	116	14,488,208	8	16	40	80
AT_Leaf	1,150	8,047,907	143	286	714	1,429
At_miR1507OX_1	8	1,478,373	5	11	27	54
At_miR1507OX_2	8	1,638,916	5	10	24	49
At_miR2109OX_1	5	1,760,055	3	6	14	28
At_miR2109OX_2	12	2,446,954	5	10	25	49
At_miR2118aOX_1	8	1,212,493	7	13	33	66
At_miR2118aOX_2	8	1,258,140	6	13	32	64
At_miR2118bOX_1	13	2,023,619	6	13	32	64
At_miR2118bOX_2	9	1,733,586	5	10	26	52
At_miR2118cOX_1	18	1,995,522	9	18	45	90
At_miR2118cOX_2	7	2,496,180	3	6	14	28
At_miROX_control	8	1,838,508	4	9	22	44
At_miROX_ck_2	18	1,804,409	10	20	50	100
hen1-8	147	5,456,831	27	54	135	269
hen1-8 ntp2-1	203	6,244,400	33	65	163	325
hen1-8 urt1-1	188	6,081,292	31	62	155	309
hen1-8 ntp4-1	148	4,626,878	32	64	160	320
hen1-8 ntp5-1	327	5,676,073	58	115	288	576
hen1-8 ntp6-1	1,893	4,328,718	437	875	2,187	4,373
hen1-8 ntp7-1	145	4,409,080	33	66	164	329
hen1-8 ntp8-1	303	8,736,008	35	69	173	347
hen1-8 ntp10-1	209	6,387,459	33	65	164	327
hen1-8 r2	83	2,874,203	29	58	144	289
hen1-8 heso1-1	88	6,015,054	15	29	73	146
hen1-8 mee44	118	3,435,030	34	69	172	344
Wt_d	139	7,517,450	18	37	92	185
Col_d	625	11,692,099	53	107	267	535

Link to FindMiRNA for this sequence