Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCAAGGAACGGATTTTGTTAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c16,157,931Phasing windowAT5G40384c16,157,82316,157,948MIR866a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c16,157,931Phasing windowath-MIR866c16,157,82316,157,948miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1154,877,516  361531
C0F202,789,465  0000
d1F103,574,742  0000
d1F223,705,660  1135
d234F141,417,116  361428
d234F2333,822,319  9174386
r2F1172,195,923  8153977
r2F2342,233,522  153076152
r2FSb125,728,276  241021
r2FNaSb155,311,047  361428
r2FNa1111,834,656  6123060
r2FNa2176,081,068  361428
r2FL51,145,942  492244
r2FD164,928,142  361632
C0FCSb29,399,678  1112
C0FSb89,361,008  1249
r2SC133,743,342  1248
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa244,617,795  1249
r2SSb53,278,680  23815
r2SNaSb43,087,212  13613
r2SC21476,105  241121
r2SP2976,646  241020
C0RC101,249,181  0000
C0RNi11,211,490  1248
AtCM014,488,208  0000
AT_Leaf18,047,907  1111
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-835,456,831  1135
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d277,517,450  471836
Col_d111,692,099  1111


Link to FindMiRNA for this sequence