Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCAAGTTTGATGACGATTCCA
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c22,084,330Phasing windowLink to IGR (6,587 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F283,822,319  241021
r2F142,195,923  24918
r2F232,233,522  13713
r2FSb115,728,276  241019
r2FNaSb115,311,047  241021
r2FNa131,834,656  23816
r2FNa2126,081,068  241020
r2FL21,145,942  23917
r2FD84,928,142  23816
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC163,743,342  23816
r2SH62,165,395  361428
r2SNa102,082,930  0000
r2SC333,997,922  1248
r2SNa214,617,795  1112
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP1976,646  12510
C0RC161,249,181  5102448
C0RNi41,211,490  371733
AtCM014,488,208  0000
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d37,517,450  1124
Col_d011,692,099  0000


Link to FindMiRNA for this sequence