Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCACTCCTCTTCTTCTTGATG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w2,165,675Phasing windowAT1G07051w2,165,5172,165,746MIR847a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w2,165,675Phasing windowath-MIR847w2,165,5172,165,746miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb15,311,047  1112
r2FNa111,834,656  1135
r2FNa216,081,068  1112
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa234,617,795  1136
r2SSb23,278,680  1136
r2SNaSb03,087,212  0000
r2SC24476,105  8174284
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf1198,047,907  153074148
At_miR1507OX_1441,478,373  3060149298
At_miR1507OX_2811,638,916  4999247494
At_miR2109OX_1531,760,055  3060151301
At_miR2109OX_2882,446,954  3672180360
At_miR2118aOX_1421,212,493  3569173346
At_miR2118aOX_2491,258,140  3978195389
At_miR2118bOX_11442,023,619  71142356712
At_miR2118bOX_2541,733,586  3162156311
At_miR2118cOX_1951,995,522  4895238476
At_miR2118cOX_2892,496,180  3671178357
At_miROX_control821,838,508  4589223446
At_miROX_ck_2581,804,409  3264161321
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-174,328,718  23816
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-148,736,008  1125
hen1-8 ntp10-116,387,459  1112
hen1-8 r212,874,203  1123
hen1-8 heso1-126,015,054  1123
hen1-8 mee4403,435,030  0000
Wt_d27,517,450  1113
Col_d3111,692,099  351327


Link to FindMiRNA for this sequence