Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCAGGTATGATTGACTTCAAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w6,740,503Phasing windowAT1G19464w6,740,5006,740,591MIR864a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w6,740,503Phasing windowath-MIR864w6,740,5006,740,591miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1134,877,516  351327
C0F232,789,465  12511
d1F113,574,742  1113
d1F203,705,660  0000
d234F1101,417,116  7143571
d234F2323,822,319  8174284
r2F1192,195,923  9174387
r2F2752,233,522  3467168336
r2FSb715,728,276  122562124
r2FNaSb455,311,047  8174285
r2FNa1111,834,656  6123060
r2FNa2416,081,068  7133467
r2FL71,145,942  6123161
r2FD564,928,142  112357114
C0FCSb19,399,678  1111
C0FSb79,361,008  1147
r2SC153,743,342  13713
r2SH352,165,395  163281162
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa284,617,795  23917
r2SSb33,278,680  1259
r2SNaSb43,087,212  13613
r2SC22476,105  482142
r2SP1976,646  12510
C0RC1391,249,181  3162156312
C0RNi521,211,490  4386215429
AtCM214,488,208  1111
AT_Leaf288,047,907  371735
At_miR1507OX_111,478,373  1137
At_miR1507OX_221,638,916  12612
At_miR2109OX_111,760,055  1136
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_202,496,180  0000
At_miROX_control21,838,508  12511
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d367,517,450  5102448
Col_d011,692,099  0000


Link to FindMiRNA for this sequence