Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCATGGTCAGATCCGTCATCC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w22,577,194Phasing windowAT1G61224w22,577,11322,577,219MIR842a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w22,577,194Phasing windowath-MIR842w22,577,06722,577,265miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F124,877,516  1124
C0F202,789,465  0000
d1F153,574,742  13714
d1F213,705,660  1113
d234F141,417,116  361428
d234F253,822,319  13713
r2F192,195,923  482041
r2F232,233,522  13713
r2FSb105,728,276  23917
r2FNaSb55,311,047  1259
r2FNa171,834,656  481938
r2FNa226,081,068  1123
r2FL31,145,942  351326
r2FD34,928,142  1136
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC1133,743,342  371735
r2SH232,165,395  112153106
r2SNa102,082,930  0000
r2SC373,997,922  24918
r2SNa2174,617,795  471837
r2SSb163,278,680  5102449
r2SNaSb163,087,212  5102652
r2SC227476,105  57113284567
r2SP19976,646  193997195
C0RC1481,249,181  3877192384
C0RNi231,211,490  193895190
AtCM014,488,208  0000
AT_Leaf198,047,907  251224
At_miR1507OX_111,478,373  1137
At_miR1507OX_211,638,916  1136
At_miR2109OX_101,760,055  0000
At_miR2109OX_222,446,954  1248
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_231,258,140  251224
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_222,496,180  1248
At_miROX_control11,838,508  1135
At_miROX_ck_241,804,409  241122
hen1-835,456,831  1135
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-164,328,718  13714
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-128,736,008  1112
hen1-8 ntp10-126,387,459  1123
hen1-8 r222,874,203  1137
hen1-8 heso1-136,015,054  1125
hen1-8 mee4413,435,030  1113
Wt_d137,517,450  23917
Col_d511,692,099  1124


Link to FindMiRNA for this sequence