Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCATTGAGTGCAGCGTTGATG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14w2,625,960Phasing windowAT4G05105w2,625,9502,626,056MIR397A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24w2,625,960Phasing windowath-MIR397aw2,625,9502,626,056miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F163,574,742  23817
d1F203,705,660  0000
d234F1601,417,116  4285212423
d234F2813,822,319  2142106212
r2F172,195,923  361632
r2F2142,233,522  6133163
r2FSb25,728,276  1123
r2FNaSb125,311,047  251123
r2FNa1951,834,656  52104259518
r2FNa206,081,068  0000
r2FL281,145,942  2449122244
r2FD2484,928,142  50101252503
C0FCSb09,399,678  0000
C0FSb79,361,008  1147
r2SC1243,743,342  6133264
r2SH1122,165,395  52103259517
r2SNa112,082,930  1125
r2SC343,997,922  12510
r2SNa234,617,795  1136
r2SSb03,278,680  0000
r2SNaSb33,087,212  12510
r2SC216476,105  3467168336
r2SP55976,646  56113282563
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM114,488,208  1111
AT_Leaf08,047,907  0000
At_miR1507OX_111,478,373  1137
At_miR1507OX_211,638,916  1136
At_miR2109OX_101,760,055  0000
At_miR2109OX_232,446,954  12612
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_212,496,180  1124
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-8215,456,831  481938
hen1-8 ntp2-11436,244,400  2346115229
hen1-8 urt1-1446,081,292  7143672
hen1-8 ntp4-1744,626,878  163280160
hen1-8 ntp5-1865,676,073  153076152
hen1-8 ntp6-12754,328,718  64127318635
hen1-8 ntp7-1134,409,080  361529
hen1-8 ntp8-1478,736,008  5112754
hen1-8 ntp10-1776,387,459  122460121
hen1-8 r2342,874,203  122459118
hen1-8 heso1-1496,015,054  8164181
hen1-8 mee44363,435,030  102152105
Wt_d07,517,450  0000
Col_d611,692,099  1135


Link to FindMiRNA for this sequence