Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TCATTGAGTGCATCGTTGATG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	c	7,878,750	Phasing window	AT4G13555	c	7,878,652	7,878,760	MIR397B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	c	7,878,750	Phasing window	ath-MIR397b	c	7,878,652	7,878,760	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	29	4,877,516	6	12	30	59
C0F2	0	2,789,465	0	0	0	0
d1F1	15	3,574,742	4	8	21	42
d1F2	0	3,705,660	0	0	0	0
d234F1	266	1,417,116	188	375	939	1,877
d234F2	99	3,822,319	26	52	130	259
r2F1	223	2,195,923	102	203	508	1,016
r2F2	4	2,233,522	2	4	9	18
r2FSb	30	5,728,276	5	10	26	52
r2FNaSb	60	5,311,047	11	23	56	113
r2FNa1	519	1,834,656	283	566	1,414	2,829
r2FNa2	0	6,081,068	0	0	0	0
r2FL	225	1,145,942	196	393	982	1,963
r2FD	694	4,928,142	141	282	704	1,408
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	28	9,361,008	3	6	15	30
r2SC1	499	3,743,342	133	267	667	1,333
r2SH	2,499	2,165,395	1,154	2,308	5,770	11,541
r2SNa1	1	2,082,930	1	1	2	5
r2SC3	8	3,997,922	2	4	10	20
r2SNa2	11	4,617,795	2	5	12	24
r2SSb	14	3,278,680	4	9	21	43
r2SNaSb	8	3,087,212	3	5	13	26
r2SC2	92	476,105	193	386	966	1,932
r2SP	131	976,646	134	268	671	1,341
C0RC1	1	1,249,181	1	2	4	8
C0RNi	0	1,211,490	0	0	0	0
AtCM	3	14,488,208	1	1	1	2
AT_Leaf	201	8,047,907	25	50	125	250
At_miR1507OX_1	19	1,478,373	13	26	64	129
At_miR1507OX_2	7	1,638,916	4	9	21	43
At_miR2109OX_1	6	1,760,055	3	7	17	34
At_miR2109OX_2	32	2,446,954	13	26	65	131
At_miR2118aOX_1	15	1,212,493	12	25	62	124
At_miR2118aOX_2	15	1,258,140	12	24	60	119
At_miR2118bOX_1	13	2,023,619	6	13	32	64
At_miR2118bOX_2	6	1,733,586	3	7	17	35
At_miR2118cOX_1	22	1,995,522	11	22	55	110
At_miR2118cOX_2	19	2,496,180	8	15	38	76
At_miROX_control	3	1,838,508	2	3	8	16
At_miROX_ck_2	2	1,804,409	1	2	6	11
hen1-8	54	5,456,831	10	20	49	99
hen1-8 ntp2-1	421	6,244,400	67	135	337	674
hen1-8 urt1-1	75	6,081,292	12	25	62	123
hen1-8 ntp4-1	88	4,626,878	19	38	95	190
hen1-8 ntp5-1	214	5,676,073	38	75	189	377
hen1-8 ntp6-1	402	4,328,718	93	186	464	929
hen1-8 ntp7-1	20	4,409,080	5	9	23	45
hen1-8 ntp8-1	76	8,736,008	9	17	43	87
hen1-8 ntp10-1	173	6,387,459	27	54	135	271
hen1-8 r2	100	2,874,203	35	70	174	348
hen1-8 heso1-1	199	6,015,054	33	66	165	331
hen1-8 mee44	140	3,435,030	41	82	204	408
Wt_d	29	7,517,450	4	8	19	39
Col_d	4	11,692,099	1	1	2	3

Link to FindMiRNA for this sequence