Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TCCAAAGGGATCGCATTGATCC
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	16,652,111	Phasing window	AT2G39885	w	16,652,101	16,652,233	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	16,652,111	Phasing window	ath-MIR393a	w	16,652,101	16,652,233	miRNA
3	3	w	20,691,657	Phasing window	AT3G55734	w	20,691,647	20,691,806	MIR393B; miRNA
4	3	w	20,691,657	Phasing window	ath-MIR393b	w	20,691,647	20,691,806	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	33	4,877,516	7	14	34	68
C0F2	0	2,789,465	0	0	0	0
d1F1	2	3,574,742	1	1	3	6
d1F2	0	3,705,660	0	0	0	0
d234F1	20	1,417,116	14	28	71	141
d234F2	18	3,822,319	5	9	24	47
r2F1	93	2,195,923	42	85	212	424
r2F2	28	2,233,522	13	25	63	125
r2FSb	195	5,728,276	34	68	170	340
r2FNaSb	134	5,311,047	25	50	126	252
r2FNa1	93	1,834,656	51	101	253	507
r2FNa2	158	6,081,068	26	52	130	260
r2FL	46	1,145,942	40	80	201	401
r2FD	152	4,928,142	31	62	154	308
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	0	9,361,008	0	0	0	0
r2SC1	20	3,743,342	5	11	27	53
r2SH	93	2,165,395	43	86	215	429
r2SNa1	12	2,082,930	6	12	29	58
r2SC3	34	3,997,922	9	17	43	85
r2SNa2	19	4,617,795	4	8	21	41
r2SSb	26	3,278,680	8	16	40	79
r2SNaSb	48	3,087,212	16	31	78	155
r2SC2	2	476,105	4	8	21	42
r2SP	3	976,646	3	6	15	31
C0RC1	8	1,249,181	6	13	32	64
C0RNi	1	1,211,490	1	2	4	8
AtCM	695	14,488,208	48	96	240	480
AT_Leaf	128	8,047,907	16	32	80	159
At_miR1507OX_1	231	1,478,373	156	313	781	1,563
At_miR1507OX_2	287	1,638,916	175	350	876	1,751
At_miR2109OX_1	237	1,760,055	135	269	673	1,347
At_miR2109OX_2	563	2,446,954	230	460	1,150	2,301
At_miR2118aOX_1	173	1,212,493	143	285	713	1,427
At_miR2118aOX_2	271	1,258,140	215	431	1,077	2,154
At_miR2118bOX_1	367	2,023,619	181	363	907	1,814
At_miR2118bOX_2	195	1,733,586	112	225	562	1,125
At_miR2118cOX_1	420	1,995,522	210	421	1,052	2,105
At_miR2118cOX_2	355	2,496,180	142	284	711	1,422
At_miROX_control	325	1,838,508	177	354	884	1,768
At_miROX_ck_2	300	1,804,409	166	333	831	1,663
hen1-8	162	5,456,831	30	59	148	297
hen1-8 ntp2-1	221	6,244,400	35	71	177	354
hen1-8 urt1-1	104	6,081,292	17	34	86	171
hen1-8 ntp4-1	143	4,626,878	31	62	155	309
hen1-8 ntp5-1	226	5,676,073	40	80	199	398
hen1-8 ntp6-1	580	4,328,718	134	268	670	1,340
hen1-8 ntp7-1	120	4,409,080	27	54	136	272
hen1-8 ntp8-1	245	8,736,008	28	56	140	280
hen1-8 ntp10-1	105	6,387,459	16	33	82	164
hen1-8 r2	160	2,874,203	56	111	278	557
hen1-8 heso1-1	324	6,015,054	54	108	269	539
hen1-8 mee44	182	3,435,030	53	106	265	530
Wt_d	542	7,517,450	72	144	360	721
Col_d	265	11,692,099	23	45	113	227

Link to FindMiRNA for this sequence