Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCGCTCTGATACCAAATTGATG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14c12,214,107Phasing windowAT4G23375c12,214,06912,214,167MIR845b; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24c12,214,107Phasing windowath-MIR845bc12,214,06912,214,167miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F154,877,516  12510
C0F202,789,465  0000
d1F113,574,742  1113
d1F203,705,660  0000
d234F131,417,116  241121
d234F2123,822,319  361631
r2F172,195,923  361632
r2F2142,233,522  6133163
r2FSb395,728,276  7143468
r2FNaSb365,311,047  7143468
r2FNa1151,834,656  8164182
r2FNa2376,081,068  6123061
r2FL91,145,942  8163979
r2FD124,928,142  251224
C0FCSb29,399,678  1112
C0FSb89,361,008  1249
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM1514,488,208  12510
AT_Leaf18,047,907  1111
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-8305,456,831  5112755
hen1-8 ntp2-1306,244,400  5102448
hen1-8 urt1-1456,081,292  7153774
hen1-8 ntp4-1314,626,878  7133367
hen1-8 ntp5-1245,676,073  482142
hen1-8 ntp6-11254,328,718  2958144289
hen1-8 ntp7-1204,409,080  592345
hen1-8 ntp8-1528,736,008  6123060
hen1-8 ntp10-1386,387,459  6123059
hen1-8 r2222,874,203  8153877
hen1-8 heso1-1416,015,054  7143468
hen1-8 mee44123,435,030  371735
Wt_d367,517,450  5102448
Col_d23211,692,099  204099198


Link to FindMiRNA for this sequence