Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TCGGACCAGGCTTCATTCCCC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 7

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	19,176,241	Phasing window	AT2G46685	w	19,176,126	19,176,261	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	19,176,241	Phasing window	ath-MIR166a	w	19,176,108	19,176,277	miRNA
3	3	w	22,922,301	Phasing window	AT3G61897	w	22,922,210	22,922,321	MIR166/MIR166B; miRNA
4	3	w	22,922,301	Phasing window	ath-MIR166b	w	22,922,206	22,922,325	miRNA
5	5	w	2,838,737	Phasing window	AT5G08712	w	2,838,650	2,838,757	MIR166/MIR166C; miRNA
6	5	w	2,838,737	Phasing window	ath-MIR166c	w	2,838,635	2,838,773	miRNA
7	5	w	2,840,708	Phasing window	AT5G08717	w	2,840,628	2,840,728	MIR166/MIR166D; miRNA
8	5	w	2,840,708	Phasing window	ath-MIR166d	w	2,840,622	2,840,734	miRNA
9	5	c	16,775,544	Phasing window	AT5G41905	c	16,775,524	16,775,658	MIR166/MIR166E; miRNA
10	5	c	16,775,544	Phasing window	ath-MIR166e	c	16,775,520	16,775,662	miRNA
11	5	w	17,516,378	Phasing window	AT5G43603	w	17,516,308	17,516,398	MIR166/MIR166F; miRNA
12	5	w	17,516,378	Phasing window	ath-MIR166f	w	17,516,301	17,516,405	miRNA
13	5	w	25,504,882	Phasing window	AT5G63715	w	25,504,813	25,504,902	MIR166/MIR166G; miRNA
14	5	w	25,504,882	Phasing window	ath-MIR166g	w	25,504,798	25,504,919	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	47,343	4,877,516	9,706	19,413	48,532	97,064
C0F2	17,650	2,789,465	6,327	12,655	31,637	63,274
d1F1	3,277	3,574,742	917	1,833	4,584	9,167
d1F2	10,503	3,705,660	2,834	5,669	14,172	28,343
d234F1	46,029	1,417,116	32,481	64,962	162,404	324,808
d234F2	215,909	3,822,319	56,486	112,973	282,432	564,864
r2F1	98,436	2,195,923	44,827	89,653	224,134	448,267
r2F2	402,109	2,233,522	180,034	360,067	900,168	1,800,336
r2FSb	348,539	5,728,276	60,845	121,691	304,227	608,454
r2FNaSb	405,038	5,311,047	76,263	152,527	381,317	762,633
r2FNa1	117,333	1,834,656	63,954	127,907	319,768	639,537
r2FNa2	281,581	6,081,068	46,305	92,609	231,523	463,045
r2FL	27,336	1,145,942	23,855	47,709	119,273	238,546
r2FD	407,668	4,928,142	82,722	165,445	413,612	827,225
C0FCSb	8,669	9,399,678	922	1,845	4,611	9,223
C0FSb	56,778	9,361,008	6,065	12,131	30,327	60,654
r2SC1	35,044	3,743,342	9,362	18,723	46,808	93,617
r2SH	13,805	2,165,395	6,375	12,751	31,876	63,753
r2SNa1	1,563	2,082,930	750	1,501	3,752	7,504
r2SC3	112,960	3,997,922	28,255	56,509	141,273	282,547
r2SNa2	112,981	4,617,795	24,466	48,933	122,332	244,664
r2SSb	77,352	3,278,680	23,592	47,185	117,962	235,924
r2SNaSb	56,665	3,087,212	18,355	36,709	91,774	183,547
r2SC2	218,772	476,105	459,504	919,007	2,297,518	4,595,037
r2SP	263,401	976,646	269,700	539,399	1,348,498	2,696,996
C0RC1	78,824	1,249,181	63,101	126,201	315,503	631,005
C0RNi	145,257	1,211,490	119,899	239,799	599,497	1,198,995
AtCM	112,323	14,488,208	7,753	15,505	38,764	77,527
AT_Leaf	69,126	8,047,907	8,589	17,179	42,947	85,893
At_miR1507OX_1	61,382	1,478,373	41,520	83,040	207,600	415,200
At_miR1507OX_2	91,783	1,638,916	56,002	112,005	280,011	560,023
At_miR2109OX_1	47,589	1,760,055	27,038	54,077	135,192	270,384
At_miR2109OX_2	149,209	2,446,954	60,977	121,955	304,887	609,774
At_miR2118aOX_1	37,895	1,212,493	31,254	62,508	156,269	312,538
At_miR2118aOX_2	73,647	1,258,140	58,536	117,073	292,682	585,364
At_miR2118bOX_1	107,937	2,023,619	53,339	106,677	266,693	533,386
At_miR2118bOX_2	49,841	1,733,586	28,750	57,500	143,751	287,502
At_miR2118cOX_1	106,392	1,995,522	53,315	106,631	266,577	533,154
At_miR2118cOX_2	100,068	2,496,180	40,088	80,177	200,442	400,885
At_miROX_control	130,336	1,838,508	70,892	141,785	354,461	708,923
At_miROX_ck_2	75,719	1,804,409	41,963	83,927	209,817	419,633
hen1-8	34,313	5,456,831	6,288	12,576	31,440	62,881
hen1-8 ntp2-1	28,112	6,244,400	4,502	9,004	22,510	45,020
hen1-8 urt1-1	31,880	6,081,292	5,242	10,485	26,212	52,423
hen1-8 ntp4-1	29,037	4,626,878	6,276	12,551	31,379	62,757
hen1-8 ntp5-1	45,551	5,676,073	8,025	16,050	40,125	80,251
hen1-8 ntp6-1	207,675	4,328,718	47,976	95,952	239,880	479,761
hen1-8 ntp7-1	26,981	4,409,080	6,119	12,239	30,597	61,194
hen1-8 ntp8-1	73,448	8,736,008	8,408	16,815	42,038	84,075
hen1-8 ntp10-1	51,120	6,387,459	8,003	16,006	40,016	80,032
hen1-8 r2	23,034	2,874,203	8,014	16,028	40,070	80,140
hen1-8 heso1-1	74,565	6,015,054	12,396	24,793	61,982	123,964
hen1-8 mee44	26,529	3,435,030	7,723	15,446	38,615	77,231
Wt_d	216,191	7,517,450	28,759	57,517	143,793	287,586
Col_d	1,336,713	11,692,099	114,326	228,652	571,631	1,143,262

Link to FindMiRNA for this sequence