Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCGGATGCGAAACGGTGGTGT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w28,889,481Phasing windowath-MIR4228w28,889,37528,889,532miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F174,877,516  13714
C0F212,789,465  1124
d1F113,574,742  1113
d1F233,705,660  1248
d234F161,417,116  482142
d234F2233,822,319  6123060
r2F1202,195,923  9184691
r2F2522,233,522  2347116233
r2FSb145,728,276  251224
r2FNaSb305,311,047  6112856
r2FNa1211,834,656  112357114
r2FNa2586,081,068  10194895
r2FL21,145,942  23917
r2FD224,928,142  492245
C0FCSb59,399,678  1135
C0FSb109,361,008  12511
r2SC193,743,342  251224
r2SH42,165,395  24918
r2SNa132,082,930  13714
r2SC3103,997,922  351325
r2SNa2174,617,795  471837
r2SSb43,278,680  12612
r2SNaSb93,087,212  361529
r2SC20476,105  0000
r2SP2976,646  241020
C0RC141,249,181  361632
C0RNi91,211,490  7153774
AtCM014,488,208  0000
AT_Leaf218,047,907  351326
At_miR1507OX_121,478,373  13714
At_miR1507OX_231,638,916  24918
At_miR2109OX_111,760,055  1136
At_miR2109OX_222,446,954  1248
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_221,733,586  12612
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_232,496,180  12612
At_miROX_control11,838,508  1135
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-134,328,718  1137
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d47,517,450  1135
Col_d311,692,099  1113


Link to FindMiRNA for this sequence