Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TCTCGCGCTTGTACGGCTTT
Length: 20 nucleotides
This small RNA sequence matches an rRNA
Number of hits: 3

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	3,145	Phasing window	AT2G01010	w	3,706	5,513	rRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	3,145	Phasing window	BLAST_rRNA_scan_7	w	1	10,000	Ribosome RNA region approximations
3	2	w	3,145	Phasing window	BLAST_rRNA_scan_8	c	1	10,000	Ribosome RNA region approximations
4	2	w	7,191,162	Phasing window	AT2G16586	w	7,190,937	7,191,938
5	3	w	14,197,116	Phasing window	AT3G41768	w	14,197,677	14,199,484	rRNA
6	3	w	14,197,116	Phasing window	BLAST_rRNA_scan_10	c	14,192,000	14,215,000	Ribosome RNA region approximations
7	3	w	14,197,116	Phasing window	BLAST_rRNA_scan_9	w	14,192,000	14,215,000	Ribosome RNA region approximations

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	32	4,877,516	7	13	33	66
C0F2	9	2,789,465	3	6	16	32
d1F1	38	3,574,742	11	21	53	106
d1F2	27	3,705,660	7	15	36	73
d234F1	103	1,417,116	73	145	363	727
d234F2	14	3,822,319	4	7	18	37
r2F1	96	2,195,923	44	87	219	437
r2F2	34	2,233,522	15	30	76	152
r2FSb	36	5,728,276	6	13	31	63
r2FNaSb	30	5,311,047	6	11	28	56
r2FNa1	106	1,834,656	58	116	289	578
r2FNa2	59	6,081,068	10	19	49	97
r2FL	41	1,145,942	36	72	179	358
r2FD	53	4,928,142	11	22	54	108
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	8	9,361,008	1	2	4	9
r2SC1	78	3,743,342	21	42	104	208
r2SH	33	2,165,395	15	30	76	152
r2SNa1	7	2,082,930	3	7	17	34
r2SC3	45	3,997,922	11	23	56	113
r2SNa2	33	4,617,795	7	14	36	71
r2SSb	12	3,278,680	4	7	18	37
r2SNaSb	12	3,087,212	4	8	19	39
r2SC2	15	476,105	32	63	158	315
r2SP	6	976,646	6	12	31	61
C0RC1	38	1,249,181	30	61	152	304
C0RNi	16	1,211,490	13	26	66	132
AtCM	198	14,488,208	14	27	68	137
AT_Leaf	1	8,047,907	1	1	1	1
At_miR1507OX_1	8	1,478,373	5	11	27	54
At_miR1507OX_2	12	1,638,916	7	15	37	73
At_miR2109OX_1	8	1,760,055	5	9	23	45
At_miR2109OX_2	4	2,446,954	2	3	8	16
At_miR2118aOX_1	14	1,212,493	12	23	58	115
At_miR2118aOX_2	11	1,258,140	9	17	44	87
At_miR2118bOX_1	8	2,023,619	4	8	20	40
At_miR2118bOX_2	5	1,733,586	3	6	14	29
At_miR2118cOX_1	7	1,995,522	4	7	18	35
At_miR2118cOX_2	10	2,496,180	4	8	20	40
At_miROX_control	18	1,838,508	10	20	49	98
At_miROX_ck_2	12	1,804,409	7	13	33	67
hen1-8	3	5,456,831	1	1	3	5
hen1-8 ntp2-1	4	6,244,400	1	1	3	6
hen1-8 urt1-1	8	6,081,292	1	3	7	13
hen1-8 ntp4-1	1	4,626,878	1	1	1	2
hen1-8 ntp5-1	7	5,676,073	1	2	6	12
hen1-8 ntp6-1	24	4,328,718	6	11	28	55
hen1-8 ntp7-1	2	4,409,080	1	1	2	5
hen1-8 ntp8-1	0	8,736,008	0	0	0	0
hen1-8 ntp10-1	3	6,387,459	1	1	2	5
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	3	6,015,054	1	1	2	5
hen1-8 mee44	2	3,435,030	1	1	3	6
Wt_d	58	7,517,450	8	15	39	77
Col_d	18	11,692,099	2	3	8	15

Link to FindMiRNA for this sequence