Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TCTCGGTTCGCGATCCACAAG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	c	19,659,666	Phasing window	AT3G53016	c	19,659,571	19,659,676	MIR851a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	c	19,659,666	Phasing window	ath-MIR851	c	19,659,532	19,659,715	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	22	4,877,516	5	9	23	45
C0F2	3	2,789,465	1	2	5	11
d1F1	7	3,574,742	2	4	10	20
d1F2	14	3,705,660	4	8	19	38
d234F1	34	1,417,116	24	48	120	240
d234F2	73	3,822,319	19	38	95	191
r2F1	73	2,195,923	33	66	166	332
r2F2	33	2,233,522	15	30	74	148
r2FSb	329	5,728,276	57	115	287	574
r2FNaSb	136	5,311,047	26	51	128	256
r2FNa1	36	1,834,656	20	39	98	196
r2FNa2	51	6,081,068	8	17	42	84
r2FL	24	1,145,942	21	42	105	209
r2FD	85	4,928,142	17	34	86	172
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	8	9,361,008	1	2	4	9
r2SC1	0	3,743,342	0	0	0	0
r2SH	0	2,165,395	0	0	0	0
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	0	3,997,922	0	0	0	0
r2SNa2	1	4,617,795	1	1	1	2
r2SSb	2	3,278,680	1	1	3	6
r2SNaSb	0	3,087,212	0	0	0	0
r2SC2	0	476,105	0	0	0	0
r2SP	0	976,646	0	0	0	0
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	1	14,488,208	1	1	1	1
AT_Leaf	1	8,047,907	1	1	1	1
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	1	1,638,916	1	1	3	6
At_miR2109OX_1	1	1,760,055	1	1	3	6
At_miR2109OX_2	0	2,446,954	0	0	0	0
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	1	1,995,522	1	1	3	5
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	1	1,838,508	1	1	3	5
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	77	5,456,831	14	28	71	141
hen1-8 ntp2-1	82	6,244,400	13	26	66	131
hen1-8 urt1-1	129	6,081,292	21	42	106	212
hen1-8 ntp4-1	72	4,626,878	16	31	78	156
hen1-8 ntp5-1	105	5,676,073	18	37	92	185
hen1-8 ntp6-1	413	4,328,718	95	191	477	954
hen1-8 ntp7-1	59	4,409,080	13	27	67	134
hen1-8 ntp8-1	124	8,736,008	14	28	71	142
hen1-8 ntp10-1	64	6,387,459	10	20	50	100
hen1-8 r2	50	2,874,203	17	35	87	174
hen1-8 heso1-1	54	6,015,054	9	18	45	90
hen1-8 mee44	76	3,435,030	22	44	111	221
Wt_d	160	7,517,450	21	43	106	213
Col_d	316	11,692,099	27	54	135	270

Link to FindMiRNA for this sequence