Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TCTCTCTGTTGTGAAGTCAAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	22,149,735	Phasing window	AT1G60072	w	22,149,718	22,149,843	MIR859a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	22,149,735	Phasing window	ath-MIR859	w	22,149,718	22,149,843	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	23	4,877,516	5	9	24	47
C0F2	3	2,789,465	1	2	5	11
d1F1	2	3,574,742	1	1	3	6
d1F2	0	3,705,660	0	0	0	0
d234F1	13	1,417,116	9	18	46	92
d234F2	9	3,822,319	2	5	12	24
r2F1	36	2,195,923	16	33	82	164
r2F2	33	2,233,522	15	30	74	148
r2FSb	132	5,728,276	23	46	115	230
r2FNaSb	69	5,311,047	13	26	65	130
r2FNa1	10	1,834,656	5	11	27	55
r2FNa2	58	6,081,068	10	19	48	95
r2FL	20	1,145,942	17	35	87	175
r2FD	62	4,928,142	13	25	63	126
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	2	9,361,008	1	1	1	2
r2SC1	2	3,743,342	1	1	3	5
r2SH	1	2,165,395	1	1	2	5
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	0	3,997,922	0	0	0	0
r2SNa2	2	4,617,795	1	1	2	4
r2SSb	0	3,278,680	0	0	0	0
r2SNaSb	1	3,087,212	1	1	2	3
r2SC2	1	476,105	2	4	11	21
r2SP	1	976,646	1	2	5	10
C0RC1	2	1,249,181	2	3	8	16
C0RNi	3	1,211,490	2	5	12	25
AtCM	13	14,488,208	1	2	4	9
AT_Leaf	35	8,047,907	4	9	22	43
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	1	1,638,916	1	1	3	6
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	1	2,446,954	1	1	2	4
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	1	1,838,508	1	1	3	5
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	1	5,456,831	1	1	1	2
hen1-8 ntp2-1	5	6,244,400	1	2	4	8
hen1-8 urt1-1	6	6,081,292	1	2	5	10
hen1-8 ntp4-1	4	4,626,878	1	2	4	9
hen1-8 ntp5-1	0	5,676,073	0	0	0	0
hen1-8 ntp6-1	13	4,328,718	3	6	15	30
hen1-8 ntp7-1	3	4,409,080	1	1	3	7
hen1-8 ntp8-1	2	8,736,008	1	1	1	2
hen1-8 ntp10-1	5	6,387,459	1	2	4	8
hen1-8 r2	1	2,874,203	1	1	2	3
hen1-8 heso1-1	5	6,015,054	1	2	4	8
hen1-8 mee44	2	3,435,030	1	1	3	6
Wt_d	159	7,517,450	21	42	106	212
Col_d	44	11,692,099	4	8	19	38

Link to FindMiRNA for this sequence