Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCTTTCTGCAAACGCCTTGGA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c5,500,143Phasing windowath-MIR2934c5,500,0325,500,152miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23c5,500,143Phasing windowath-MIR782w5,500,0375,500,147miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F212,789,465  1124
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F233,822,319  1248
r2F102,195,923  0000
r2F212,233,522  1124
r2FSb05,728,276  0000
r2FNaSb105,311,047  24919
r2FNa101,834,656  0000
r2FNa266,081,068  12510
r2FL01,145,942  0000
r2FD14,928,142  1112
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf38,047,907  1124
At_miR1507OX_101,478,373  0000
At_miR1507OX_221,638,916  12612
At_miR2109OX_101,760,055  0000
At_miR2109OX_222,446,954  1248
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-845,456,831  1147
hen1-8 ntp2-156,244,400  1248
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-134,626,878  1136
hen1-8 ntp5-135,676,073  1135
hen1-8 ntp6-1114,328,718  351325
hen1-8 ntp7-134,409,080  1137
hen1-8 ntp8-138,736,008  1123
hen1-8 ntp10-136,387,459  1125
hen1-8 r212,874,203  1123
hen1-8 heso1-176,015,054  12612
hen1-8 mee4423,435,030  1136
Wt_d37,517,450  1124
Col_d16911,692,099  142972145


Link to FindMiRNA for this sequence